Supercharge Your Innovation With Domain-Expert AI Agents!

Application of long non-coding RNA in regulation and control of colorectal cancer 5-FU drug resistance

A colorectal cancer, colorectal technology, applied in the field of bioengineering, can solve problems such as no suitable

Active Publication Date: 2021-03-19
THE SIXTH AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the latest research on tumor 5-FU drug resistance, studies have found that lncRNA may play an important role in tumor 5-FU drug resistance in many aspects, but at this stage there is no suitable lncRNA as a clinical screening method for 5-FU drug-resistant patients. Molecular targets, therefore, it is of great guiding significance to find suitable lncRNAs as molecular targets for screening 5-FU drug-resistant patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of long non-coding RNA in regulation and control of colorectal cancer 5-FU drug resistance
  • Application of long non-coding RNA in regulation and control of colorectal cancer 5-FU drug resistance
  • Application of long non-coding RNA in regulation and control of colorectal cancer 5-FU drug resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 found the differential expression of lnc-OXR1-1:3 in drug-resistant cell lines and sensitive cell lines

[0038] The inventors performed differential analysis on the RNAseq of four colorectal cancer cell lines (derived from ATCC) in vitro, including 5-FU relatively drug-resistant cell lines (HCT15, HCT15 / 5FU) and relatively sensitive cell lines (HCT116, RKO), Through the differential gene analysis of the three groups of HCT116 and HCT15, RKO and HCT15, HCT15 and HCT15 / 5-FU, and then take the intersection of the three groups of differential genes, the results are as follows figure 1 As shown in A. ENSG00000254615 with the most obvious difference was selected and verified by qRT-PCR, and the expression level was verified in drug-resistant colorectal cancer tissues and sensitive tissues. It was also found that ENSG00000254615 was highly expressed in sensitive tissues. The results are as follows figure 1 Shown in B.

[0039] In addition, the inventor found tha...

Embodiment 2

[0041] Reality Example 2 Relationship between lnc-OXR1-1:3 and colorectal cancer cells and drug resistance

[0042] In order to verify the relationship between lnc-OXR1-1:3 and colorectal cancer cells, the inventors used shRNA-mediated gene silencing expression method to down-regulate the expression of lnc-OXR1-1:3, the shRNA sequence used for expression is as follows :

[0043] shRNA#1

[0044] Justice Chain:

[0045] CCGGAAGCAAAAACACCTTTTTGAACTCGAGTTCAAAAAAGGTGTTTTTGCTTTTTTTG (SEQ ID NO: 2)

[0046] Antisense strand:

[0047] AATTCAAAAAAAGCAAAAAACACCTTTTTGAACTCGAGTTCAAAAAAGGTGTTTTTGCTT (SEQ ID NO: 3).

[0048] shRNA#2

[0049] Justice Chain:

[0050] CCGGGGAGTTCTCCACATGTAAATACTCGAGTATTTACATGTGGAGAACTCCTTTTTG (SEQ ID NO: 4)

[0051] Antisense strand:

[0052] AATTCAAAAAGGAGTTCTCCACATGTAAATACTCGAGTATTTACATGTGGAGAACTCC (SEQ ID NO: 5).

[0053] In this experiment, two shRNA sequences (shRNA#1 and shRNA#2) were used to silence the expression of lnc-OXR1-1:3 to avoid th...

Embodiment 3

[0057] Example 3 Influence of lnc-OXR1-1:3 on tumor in vivo

[0058] In the in vivo experiment, by constructing a stable knockdown cell line of lnc-OXR1-1:3 (named 4615 in the experiment), a total of 3 groups: shNC, sh4615#1, sh4615#2, in immunodeficiency mice Balb / c -nude mice were subjected to subcutaneous tumor formation experiments. After tumor formation, they were divided into two groups, and PBS and 5-FU (50mg / kg) were injected intraperitoneally every week to observe the subcutaneous tumor formation of the animals, record the tumor growth, and finally treat Mice were euthanized and tumors were harvested to measure weight. The result is as Image 6 As shown in A and 6B, no matter in which large group, lnc-OXR1-1:3 down-regulated group (sh-lnc-OXR1-1:3#1, sh-lnc-OXR1-1:3#2 ), the tumors grow faster. The result is as Image 6 As shown in C, after injection of 5-FU, mice in the control group (i.e., not treated with silencing lnc-OXR1-1:3) had a decrease in tumor weight...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides lncRNA participating in regulation and control of human colorectal cancer drug resistance. A nucleotide sequence of a transcript of the lncRNA is as shown in SEQ ID NO: 1. The expression difference of the lncRNA of which the transcript sequence is as shown in SEQ ID NO: 1 in two kinds of cells is discovered for the first time, the lncRNA is expressed at a low level in drug-resistant cells, the expression level in colorectal cancer drug-resistant tissues is lower than that in sensitive tissues, and the lncRNA can be used as a molecular marker for diagnosing the sensitivity and drug resistance of 5-fluorouracil. The sensitivity and drug resistance of a colorectal cancer patient to the 5-fluorouracil can be distinguished by detecting the expression level of the lncRNA,and then the drug resistance of the patient to the 5-fluorouracil is reduced by improving the expression level of the lncRNA, so that the treatment effect of the 5-fluorouracil is improved.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to the application of a long-chain non-coding RNA in regulating 5-FU drug resistance of colorectal cancer. Background technique [0002] Long non-coding RNAs (Long non-coding RNAs, lncRNAs) are a class of transcripts longer than 200 bases that do not have protein-coding potential. These RNA molecules are intergenic (between protein-coding genes or long intergenic non-coding RNA) introns or natural antisense transcripts (NATs), or they are transcribed from different enhancers and promoters. LncRNAs regulate gene transcription by binding to chromatin modifiers, nuclear heterogeneous nuclear proteins (hnRNPs) or transcription factors. In addition, lncRNAs target and regulate the splicing, modification or translation of host mRNAs through post-transcriptional mechanisms. [0003] At present, the specific mechanism of 5-fluorouracil (5-FU) drug resistance in colorectal cancer is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113A61K31/7105A61P1/00A61P35/00C12Q1/6886
CPCC12N15/113A61P1/00A61P35/00C12Q1/6886C12N2310/11C12Q2600/158C12Q2600/178C12Q2600/106
Inventor 邓艳红傅炀黄润庆黎健霞谢宇茜胡华斌张剑威
Owner THE SIXTH AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com