high affinity pvr mutant

A mutant and protein mutant technology, applied in the field of high-affinity PVR protein mutants, can solve the problems of tumor immune tolerance and immune escape, poor tumor treatment effect, T cell exhaustion, etc. Cytokine secretion, lowering the cost of treatment, lowering the effect of dose

Active Publication Date: 2022-06-28
ZHENGZHOU UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The immune checkpoint molecules on the surface of T cells interact with the overexpressed ligands on tumor cells, causing T cells to fall into a state of exhaustion, resulting in tumor immune tolerance and immune escape and poor tumor treatment effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • high affinity pvr mutant
  • high affinity pvr mutant
  • high affinity pvr mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Construction of lentiviral vector pLVXpuro-hPVR.

[0029] (1) PCR amplification: hPVR gene was amplified from cDNA by using KOD-Plus-Neo high-fidelity amplification enzyme (TOYOBO).

[0030] The amplification primers are:

[0031] hPVR-F:aaggatccgccaccatggcccgagc;

[0032] hPVR-R: cctctagatcaattacggcagctct;

[0033] The PCR conditions are: 94°C for 2min, 98°C for 10s, 55°C for 2min, and after 25 cycles, 68°C for 5min.

[0034] (2) PCR product gel recovery: After the PCR product was subjected to DNA gel electrophoresis, it was purified and recovered according to the instructions of the DNA gel recovery kit (AXYGEN) to obtain the hPVR gene fragment.

[0035] (3) Digestion of the target gene and vector: use endonuclease BamHI, XbaI (NEB), the target fragment recovered from the glue in step (2) and the lentiviral vector pLVX-puro (preserved by the laboratory) 37 Digestion at ℃, 2h.

[0036] (3) Gel recovery of digested products: After DNA gel electrophoresis...

Embodiment 2

[0039] Example 2: Construction of pLVXpuro-hPVR mutant protein lentiviral vector

[0040] (1) Design of PCR primers: According to the gene sequence and codon table of hPVR mutant proteins, primers for the four hPVR protein mutants were designed. The gene sequence of the mutant protein is thus as follows:

[0041] Mutant S72R:

[0042]

[0043]

[0044] Mutant S72W:

[0045]

[0046] Mutant G131V:

[0047]

[0048]

[0049] Mutant S132Q:

[0050]

[0051] The primer sequences are:

[0052] mutant S72R

[0053] hPVR-S72R-F: gcggcatggtgaacgtggcagcatggccgt;

[0054] hPVR-S72R-R:acggccatgctgccacgttcaccatgccgc;

[0055] mutant S72W

[0056] hPVR-S72W-F: gcggcatggtgaatggggcagcatggccgt;

[0057] hPVR-S72W-R:acggccatgctgccccattcaccatgccgc;

[0058] Mutant G131V

[0059] hPVR-G131V-F: cacgttcccgcaggtcagcaggagcgtgga;

[0060] hPVR-G131V-R:tccacgctcctgctgacctgcgggaacgtg;

[0061] mutant S132Q

[0062] hPVR-S132Q-F:gttcccgcagggccagaggagcgtggatat;

[0063] h...

Embodiment 3

[0071] Example 3: Construction of hPVR and hPVR gene mutant overexpression stable cell lines

[0072] 3.1 Cell Recovery and Culture

[0073] (1) Recovery of HEK-293T cells and CHO-K1 cells: Preheat fresh DMEM and RPMI 1640 medium in a 37°C water bath. Take out HEK-293T cells and CHO-K1 cells from the -80°C refrigerator, quickly put them into a 37°C water bath, and shake slowly to melt them. The thawed cell suspension was centrifuged at 1000 rpm at 25°C for 5 min. After centrifugation, the supernatant was discarded, and HEK-293T cells were added to 1 mL of preheated DMEM medium, and CHO-K1 cells were added to 1 mL of preheated RPMI 1640 medium to resuspend. Transfer the cell suspension to a petri dish, add the corresponding culture medium to 10mL, shake gently and place at 37°C, 5% CO 2 cultured in an incubator.

[0074] (2) Cell passage: When the cells cover the bottom of the dish, discard the old culture medium. Slowly add 10mL of PBS7.2 to wash the cells with a pipette ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses several high-affinity PVR mutants. The PVR mutants with higher affinity to TIGIT are obtained by mutating a certain amino acid site of wild-type PVR or its isomorphic variants. The PVR mutant of the present invention has high affinity. The present invention also provides the use of the mutant or its preparation in the preparation of medicines for treating, preventing, or alleviating tumor-related diseases.

Description

Technical field: [0001] The invention relates to the field of molecular biology, in particular to a high-affinity PVR protein mutant, protein structure, corresponding amino acid, corresponding gene sequence, preparation method and application. [0002] technical background: [0003] In recent years, malignant tumors are one of the most serious diseases that endanger human health. Tumor immunotherapy has become the most eye-catching treatment after traditional surgery, radiotherapy, chemotherapy, and targeted therapy. Immunotherapy targeting immune suppression in the tumor microenvironment was ranked first among the top ten scientific breakthroughs selected by the magazine Science in 2013. The 2018 Nobel Prize in Physiology or Medicine was awarded to two immunologists in the field of tumor immunotherapy in recognition of their contributions to the field of cancer immunity. [0004] The process of immune response is a delicate balance process between the inflammatory mechanis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/705C12N15/12A61K38/17A61P35/00A61P37/02A61P31/00
CPCC07K14/70596A61P35/00A61P37/02A61P31/00A61K38/00Y02A50/30
Inventor赵文珊高艳锋周晓文周秀曼祁元明吴亚红翟文杰
OwnerZHENGZHOU UNIV