A Molecular Marker Closely Linked to Vitality Traits of Sweet Corn Seeds and Its Application

A technology of molecular markers and sweet corn, applied in the field of molecular biology, can solve the problems of hindered starch synthesis, negative correlation of sugar content, low emergence rate of sweet corn, etc., and achieve the effect of improving seed vigor and shortening the breeding process

Active Publication Date: 2021-07-30
CROP RES INST GUANGDONG ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The formation of sweet corn is closely related to the starch synthesis and metabolism of the grain. During the synthesis of glucose and starch in the grain, due to the mutation of one or several genes, the starch synthesis may be blocked, and glucose and other carbohydrates may accumulate. However, Seed emergence rate is positively correlated with seed starch content, and negatively correlated with sugar content, resulting in lower emergence rate and weak seedling vigor of sweet corn than ordinary corn. This phenomenon is more prominent in super sweet corn. Therefore, improving sweet corn Seed vigor is the most urgent issue that breeders are most concerned about. However, there are few studies on the genetic basis of sweet corn seed vigor, and there are no reports on the cloning of genes related to seed vigor.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Molecular Marker Closely Linked to Vitality Traits of Sweet Corn Seeds and Its Application
  • A Molecular Marker Closely Linked to Vitality Traits of Sweet Corn Seeds and Its Application
  • A Molecular Marker Closely Linked to Vitality Traits of Sweet Corn Seeds and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1. Experimental materials: 295 Temperate Tropical Sweet Corn Self-tone from China, the United States, Thailand, constitutes the associated group of all genome association analysis (provided by the Research Institute of Crop Body, Guangdong Academy of Agricultural Sciences), which has rich Genetic diversity.

[0037] Sample source is shown in Table 1.

[0038] Table 1

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048] 2. Field Test Design: In 2017, it was planted in the Guangzhou Dafeng Base. It adopts a complete random area design, two repetitions, 0.25 meters per line, 10 plants, fertilization, watering, weeding and other field management measures in accordance with local Normal levels are managed, physiological mature, harvest, naturally dry.

[0049] 3. Associated group Phenotype Identification: After the dried, each self-container is selected from 3-5 sizes uniform cutting hair, take 30 capsules, uniform seeds, sod...

Embodiment 2

[0056] Example 2, SNP site screening and target gene positioning

[0057] All genome association analysis: By reducing the associated group, a total of 9.8 million high-quality SNP sites, combined with 9.8 million SNP, group structure, intra-affinity and seed vitality related traits of associated groups, using Tassel The MLM model performs all genome association analysis, and 1 candidate gene (ZM00001D027504) (ZM00001D027504) (ZM00001D027504) is found on the 1st chromosome (P ≤ 1 × 10-6), and the nucleotide sequence is derived from the Gramene website. At 1: 6907596-6912220), the gene encodes a triphosphate nucleoside, and there is three unsecured SNP sites on the sixth exon of the gene, one of which SNP sites (named mark S1_6908324) And seed sprouts significantly correlated (p = 5.19216e-08), can explain 11.9% of phenotypic variation, other two SNP sites (named marked S1_6908332 and mark S1_6908437 respectively) also associated with seed germination, but not significant Embodimen...

Embodiment 3

[0059] Example 3, ZM00001D027504 gene of molecular marker primer design

[0060] For marking S1_6908324, marking S1_6908332, marking S1_6908437, and marking S1_6907721, an allele-specific KASP primer is used to amplify and detect, and 19-21 bases labeled F1 and F2 primers are selected on the left side of the SNP position, and take the SNP A base of the variation site is a F1 primer, and the other base is a F2 primer, and the upper two joints are connected, and 19-22 bases is selected from the right 40-100 bp, respectively, thereby passing through the fluorescence detection platform. The purpose of detecting different SNP genotypes.

[0061] The primer sequences of the label S1_6908324 are as follows:

[0062] Ph1f1: gaaggtgaccaagttcatgcttgtgcctccccccccccgtacatgcc (SEQ ID NO: 1)

[0063] PH1F2: gaaggtcggggggtcaacgatttgtgcctcccccccgtacatgct (SEQ ID NO: 2)

[0064] PH1R: CatgaagtccttcgtcagaGc (SEQ ID NO: 3)

[0065] The primer sequences of the label S1_6908332 are as follows:

[0066...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular biology, and specifically discloses a molecular marker closely linked with the vitality traits of sweet corn seeds and its application. The 6th exon of the Zm00001d027504 gene in the maize chromosome 1 contains three SNP markers, which are respectively marker S1_6908324, marker S1_6908332 and marker S1_6908437, and the 3'UTR region contains the fourth SNP marker - marker S1_6907721, marker S1_6908324, marker S1_6908324, The physical locations of token S1_6908332 and token S1_6908437 are 6908324, 6908332 and 6908437 respectively, and the physical location of token S1_6907721 is 6907721. The invention discovers the above four molecular markers, and provides a new approach for improving the vigor and breeding of maize seeds.

Description

Technical field [0001] The present invention relates to the field of molecular biology, and more particularly to a molecular marker and application of tight linkage with a steeled corn seed activity. Background technique [0002] Sweet corn is a subspecies of maize, originated in the continent, is a budget crop integrating grains, fruit, vegetables, and feeding, has more than 100 years of human growing and edible corn. Sweet jade fresher can be directly listed or processed, and the grains are rich in protein, water-soluble polysaccharides, multiple free amino acids and vitamins, have higher nutritional value, processing value and economic value. With the improvement of people's living standards, sweet corn also ushered in more consumers. The United States is the earliest country in the world, the earliest country, early in the world, as early as 1828, the American Sab has published the first papers on the study of sweet corn, and 1836 Nos Dalin has cultivated the first sweet Corn...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6895C12Q2600/13C12Q2600/156C12Q2600/172C12Q2531/113C12Q2563/107
Inventor肖颖妮胡建广李高科于永涛李坤
OwnerCROP RES INST GUANGDONG ACAD OF AGRI SCI