Unlock instant, AI-driven research and patent intelligence for your innovation.

Primers and method for rapidly identifying and quantifying schizosaccharomyces pombe

A technology of Schizosaccharomyces pombe and yeast, which is applied in the field of bioengineering, can solve the problems of low success rate, long cycle and high cost, and achieve the effects of high accuracy, good effectiveness and high sensitivity

Pending Publication Date: 2021-04-06
JIANGNAN UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The technical problem to be solved by the present invention is that the existing method for identifying Schizosaccharomyces pombe mainly utilizes the physical and chemical properties of the strain or ITS4. This identification method has problems such as long period, high cost, and low success rate.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and method for rapidly identifying and quantifying schizosaccharomyces pombe
  • Primers and method for rapidly identifying and quantifying schizosaccharomyces pombe
  • Primers and method for rapidly identifying and quantifying schizosaccharomyces pombe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Design of Schizosaccharomyces pombe specific primers

[0034] Design method of specific primer pair:

[0035] Schizosaccharomyces pombe is the core yeast in the liquor brewing system, and the Kyoto Encyclopedia of Genes and Genomes Metabolic Pathway (KEGG Pathway) was used to search for the specific enzyme of Schizosaccharomyces pombe—alcohol dehydrogenation in Schizosaccharomyces pombe Enzyme (Schizosaccharomyces pombe alcohol dehydrogenase NADP), obtain the 966bp nucleotide sequence encoding this specific enzyme, the sequence is as follows:

[0036] atgtctgctgaacaaaagtatttcgaaaacgctcaaaacgttcatttcacacttgctgatggcagcaaaatccccggtttgggattgggtacctggagatcggagcccaatcaaactaaaaatgccgtaaagactgccttacaatatggctatcgccatattgatgcagcagccatctacggtaacgaggatgaagtaggtgatggcattaaagagagtggtgttcctcgcaaggacatttgggttacctcgaagctttggtgtaatgctcacgctcccgaggcagttcccaaggctttagagaagacattgaaagacttaaagttagactacttggatgaatatcttatccattggcctgtcagctttaagactggtgaggataaattccccaaagacaaggatggaaatctca...

Embodiment 2

[0039] Example 2: Screening of Schizosaccharomyces pombe specific primers

[0040] First, the core yeast was screened from the fermentation process of Maotai-flavor liquor, and 10g of fermented grains were weighed into a sterilized 250mL Erlenmeyer flask containing 100mL of sterile PBS buffer and 3g of glass beads, and then placed at 30°C, Shake at 200r / min to mix for 30min, and let stand for 5min to obtain the bacterial suspension. Dilute the bacterial suspension, take 10 -3 、10 -4 and 10 -5 Three dilutions of sample bacterial suspensions were spread on YPD medium plates and cultured in a 30°C incubator for 72 hours. Single colonies on the plates were picked and numbered as the core yeast analogous strains.

[0041] Then, the sorghum extract used for the production of Maotai-flavor liquor was used to prepare the slant medium, and the screened core yeast similar strains were isolated and purified, then transferred to the test tube slant, cultured at 30°C, and stored at 4°C ...

Embodiment 3

[0056] Example 3: Validation of Schizosaccharomyces pombe-specific primer pairs

[0057] Verification of specific primer pairs:

[0058] PCR was performed using the extracted genome of Schizosaccharomyces pombe (SP) as a template and the above-mentioned specific primers R1A1F-GCTGATGGCAGCAAAATCCC and R1A1R-TTGCGAGGAACACCACTCTC as primers. Negative controls were the core yeast Saccharomyces cerevisiae in the liquor brewing system: Pichia kudriavzevii (PK), Saccharomyces cerevisiae (SC), Zygosaccharomycesbailii (ZB), white sham Silk yeast (Candida humilis, CH), Pasteurian yeast (Kazachstania barnettii, KB) and redistilled water (dd H 2 O). The PCR system and PCR conditions are the same as in Example 2. After the PCR is finished, the product is subjected to gel electrophoresis, and the bands on the gel are observed by a gel imager to confirm the specificity of the primers, such as figure 2 As shown, Schizosaccharomyces pombe has obvious target bands around 100-250 bp, and th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers and a method for rapidly identifying and quantifying schizosaccharomyces pombe, and belongs to the technical field of bioengineering. A specific primer pair R1A1F / R1A1R is designed for schizosaccharomyces pombe ethanol dehydrogenase, the sequences are shown as SEQ ID NO:2 and SEQ ID NO:3, and rapid qualitative and quantitative detection of schizosaccharomyces pombe in samples such as yeast for making hard liquor and fermented grains can be achieved through a PCR technology; and accuracy is high, effectiveness is good, and sensitivity is high. The technical scheme of the invention is suitable for fermented food finished products or samples taken from the fermentation process of fermented food.

Description

technical field [0001] The invention relates to a primer and a method for quickly identifying and quantifying Schizosaccharomyces pombe, belonging to the technical field of bioengineering. Background technique [0002] At present, most of the famous liquors in China are brewed using the traditional Daqu method. Daqu is made from barley, wheat, peas, etc., which are crushed, mixed with water, pressed into brick-shaped fermented grains, and cultivated under artificially controlled temperature and humidity. Daqu is rich in mold, yeast, bacteria and other microorganisms and various enzymes produced by them. It is a mixed crude enzyme preparation of multiple strains, and the role of fungi cannot be ignored. Due to the abundant microorganisms in Daqu, adding koji not only directly transfers a large number of beneficial wine-making microorganisms to the fermented grains, but also provides various enzymes mainly amylase and protease to the fermented grains. At the same time, Daqu ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/686C12Q1/6851C12Q1/6895C12Q1/06C12Q1/04C12N15/11
CPCC12Q1/686C12Q1/6851C12Q1/6895C12Q2565/125C12Q2535/122C12Q2531/113C12Q2563/107C12Q2545/114
Inventor 杜海徐岩周天慈孙佳
Owner JIANGNAN UNIV