Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of nanobody against B cell maturation antigen and its application

A nanobody and B cell technology, applied in the field of biomedicine, can solve the problem of not achieving the ideal effect, and achieve the effect of improving the killing ability

Active Publication Date: 2022-07-29
HUADAO SHANGHAI BIOPHARMA CO LTD
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The concept of Chimeric antigen receptor T cells (CAR-T) has appeared as early as 1989, but it has not achieved the desired effect in clinical trials.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of nanobody against B cell maturation antigen and its application
  • A kind of nanobody against B cell maturation antigen and its application
  • A kind of nanobody against B cell maturation antigen and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] This example is used for the construction and panning of a phage nanobody library, and ELISA is used for preliminary screening. Specific steps are as follows:

[0065] (1) Construction of phage nanobody library

[0066] Bactrian camels were immunized with BCMA-Fc expressing the extracellular region, and after ELISA was used to verify the titer, 200 mL of peripheral blood was drawn; lymphocytes were sorted to obtain peripheral blood mononuclear lymphocyte precipitates, and RNA was extracted; III reverse transcriptase uses RNA as a template to synthesize the first-strand cDNA, and then uses nested PCR to amplify the VHH gene; insert the VHH gene into the pMECS phage display vector, and electrotransform TG1 competent cells, and take an appropriate amount of bacterial liquid for library identification , all the remaining cultures were evenly spread on the LB / AMPGLU plate. After the bacteria grew out, the bacterial lawn was collected, and 1 / 3 volume of 50% glycerol was add...

Embodiment 2

[0080] In this example, the candidate clones were screened by flow cytometry (Fluorescence activated CellSorting, FACS).

[0081] Cells were cultured according to standard cell culture protocols, and cells were digested with trypsin to prepare BCMA-positive and negative cell suspensions; centrifuged at 300 g for 5 min to remove the culture medium, and resuspended cells in Flow Buffer to 2×10 6 cells / mL; add 2 x 10 to each well in a V-bottom 96-well plate 5Cells were centrifuged at 300g for 5min, the supernatant was removed, the crude VHH antibody extract was added to resuspend the cells, and the cells were incubated at 4°C for 1h;

[0082] After centrifugation at 300 g for 5 min, remove the supernatant, resuspend the cells in Flow Buffer, dilute APCanti-his antibody to 2 μg / mL in Flow Buffer, resuspend cells in 100 μL per well, and incubate at 4°C for 1 h; wash the cells with Flow Buffer for 3 times and then use 200 μL Flow Buffer Cells were resuspended and analyzed by flow c...

Embodiment 3

[0084] In this example, the VHH-mIgG2a Fc nanobody was expressed and purified, and the antibody affinity was determined. In order to further identify the antibodies obtained by screening, the antibodies need to be expressed by mammalian cells. Therefore, a plasmid vector expressing VHH with a mouse Fc tag was constructed first, which is denoted as C-4 pCP.Stuffer-mCg2a-FC. The specific steps are as follows:

[0085] 1. Amplify BCMA VHH B8 by PCR with primers:

[0086] HDB8-F (SEQ ID NO. 10):

[0087] CGCGATTCTTAAGGGTGTCCAGTGCGAGGTTGCAGCTGGTGGA;

[0088] HD-B8-R (SEQ ID NO. 11):

[0089] GCATGGAGGACAGGGCTTGATTGTGGGGCTAGACACTGTCACCTG

[0090] The reaction system is shown in Table 2, and the amplification procedure is shown in Table 3 below:

[0091] Table 2

[0092]

[0093] table 3

[0094]

[0095] 2. The digestion system is shown in Table 4. The digestion temperature is 37°C and the time is 6h. The PCR purification kit was used for purification, and the recover...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a nanobody against B cell maturation antigen and its application. The heavy chain variable region of the anti-B cell maturation antigen Nanobody includes: the complementarity determining region 1 shown in SEQ ID NO.1, the complementarity determining region 2 shown in SEQ ID NO.2 and the complementarity determining region shown in SEQ ID NO.3. Complementarity determining region 3 shown. In the present invention, the antibody screened by the phage display nanobody library has a specific CDR region, and the obtained antibody can specifically bind the BCMA antigen with good affinity; it is used as the antigen binding domain to construct a chimeric antigen receptor and CAR-T It has obvious killing activity to BCMA-positive tumor cells. Therefore, the nanobody has broad application prospects in the immunotherapy of multiple myeloma.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a nanobody against B cell maturation antigen and its application. Background technique [0002] Multiple myeloma (MM) is a malignant proliferative disorder of plasma cells characterized by abnormal proliferation of clonal plasma cells in the bone marrow, which secrete monoclonal immunoglobulin or its fragment (M protein) and cause associated organs or tissues. damage. Common clinical manifestations include bone pain, anemia, renal insufficiency and infection. MM is the second most common hematological malignancy in many countries, accounting for about 10% of hematological malignancies. There is no exact epidemiological survey data on the incidence of MM in my country, which is generally estimated to be about 1 / 100,000, and the median survival time of multiple myeloma is 3.5. [0003] Although the current induction therapy for MM shows a certain curative effect,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/28C12N15/13C07K19/00C12N15/867C12N5/10A61K39/00A61P35/00
CPCC07K16/2878C07K14/7051C07K14/70517C07K14/70578C12N5/0636C12N15/86A61K39/001117A61P35/00C07K2317/565C07K2317/56C07K2317/567C07K2319/02C07K2319/03C07K2319/33C07K2319/74C12N2740/15043C12N2800/107C12N2510/00A61K2039/5156A61K2039/804C07K2317/569
Inventor 狄升蒙侯莉余学军
Owner HUADAO SHANGHAI BIOPHARMA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com