Anti-BCMA antigen binding fragment and application thereof

A technology combining fragments and BCMA-55, applied in the field of biomedicine, can solve the problems of high effective drug clearance rate, failure to solve the recurrence rate of patients, etc., and achieve the effect of improving the killing ability

Active Publication Date: 2021-05-25
HUADAO SHANGHAI BIOPHARMA CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although traditional treatment methods such as protease inhibitors (PI) and immunomodulators (IMID) have shown good curative effects, they still have not solved the problems of high relapse rate and low drug clearance rate.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-BCMA antigen binding fragment and application thereof
  • Anti-BCMA antigen binding fragment and application thereof
  • Anti-BCMA antigen binding fragment and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] This example is used for the construction and panning of the phage nanobody library, and ELISA is used for preliminary screening. Specific steps are as follows:

[0063] (1) Construction of phage nanobody library

[0064] Bactrian camels were immunized with BCMA-Fc expressing the extracellular region, and after the titer was verified by ELISA, 200 mL of peripheral blood was drawn; lymphocytes were sorted, and peripheral blood mononuclear lymphocyte precipitates were obtained, and RNA was extracted; III reverse transcriptase uses RNA as a template to synthesize the first-strand cDNA, and then uses nested PCR to amplify the VHH gene; inserts the VHH gene into the pMECS phage display vector, and after electrotransforming TG1 competent cells, take an appropriate amount of bacterial liquid for library identification , all the remaining cultures were evenly spread on LB / AMPGLU plates, and the lawn was collected after the bacteria grew out, and 1 / 3 of the volume of 50% glyce...

Embodiment 2

[0078] In this example, the candidate clones were screened using the flow cytometry fluorescence sorting technique (Fluorescence activated Cell Sorting, FACS).

[0079] Carry out cell culture according to the standard cell culture protocol, use trypsin to digest cells to prepare BCMA-positive and negative cell suspensions; 6 cell / mL; Add 2×10 to each well in a V-bottom 96-well plate 5 After centrifuging at 300g for 5min, remove the supernatant, add the crude extract of VHH antibody to resuspend the cells, and incubate at 4°C for 1h;

[0080]After centrifuging at 300g for 5 minutes, remove the supernatant, resuspend the cells in Flow Buffer, dilute the APCanti-his antibody to 2 μg / mL with Flow Buffer, resuspend the cells in 100 μL per well, and incubate at 4 °C for 1 hour; wash the cells with Flow Buffer 3 times, then use 200 μL Flow Buffer Cells were resuspended and analyzed by flow cytometry.

Embodiment 3

[0082] In this example, the VHH-mIgG2a Fc nanobody was expressed and purified, and the antibody affinity was measured. In order to further identify the screened antibodies, the antibodies need to be expressed by mammalian cells. Therefore, a plasmid vector expressing VHH with a mouse Fc tag was firstly constructed, which was denoted as C-4pCP.Stuffer-mCg2a-FC, and the specific steps were as follows:

[0083] 1. Using PCR to amplify BCMA VHH B55, the primers are:

[0084] HD-F (SEQ ID NO. 10):

[0085] CGCGATTCTTAAGGGTGTCCAGTGCGAGGTGCAGCTGGTGGA;

[0086] HD-B55-R (SEQ ID NO.11):

[0087] GCATGGAGGACAGGGCTTGATTGTGGGAGAAGACACTGTCACCTG

[0088] The reaction system is shown in Table 2, and the amplification program is shown in Table 3 below:

[0089] Table 2

[0090]

[0091] table 3

[0092]

[0093] 2. The enzyme digestion system is shown in Table 4. The enzyme digestion temperature is 37°C and the time is 6 hours. The PCR purification kit was used for purification...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Cell densityaaaaaaaaaa
Login to view more

Abstract

The invention provides an anti-BCMA antigen binding fragment and application thereof. A heavy chain variable region of the antigen binding fragment of the anti-B cell maturation antigen comprises a complementary determining region 1 as shown in SEQ ID NO. 1, a complementary determining region 2 as shown in SEQ ID NO. 2 and a complementary determining region 3 as shown in SEQ ID NO. 3. The antibody screened by using a phage display antigen binding fragment library has a specific CDR region, the obtained antibody can be specifically bound with a BCMA antigen, the affinity is good, the Ka (1 / Ms) is 2.81 E + 06, the Kd (1 / s) is 4.36 E-04, and the KD (M) is 1.55 E-10; when being used as an antigen binding structural domain to construct a chimeric antigen receptor and a CAR-T cell, the anti-BCMA antigen binding fragment has a wide application prospect in the aspect of immunotherapy of multiple myeloma.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to an antigen-binding fragment of anti-B cell mature antigen and application thereof. Background technique [0002] Multiple myeloma (multiple myeloma, MM) is a malignant tumor of plasma cells, the second most common tumor in the blood system, and it is still incurable. Monoclonal proliferation of plasma cells in the bone marrow and secretion of monoclonal immunoglobulin or its fragments (myeloma protein, M protein) are its main features; common clinical manifestations are bone pain, anemia, renal insufficiency, and infection. [0003] Although traditional treatment methods such as protease inhibitors (PI) and immunomodulators (IMID) have shown good curative effects, they still have not solved the problems of high relapse rate and low drug clearance rate. Patients with relapsed-refractory multiple myeloma (RRMM) who are refractory to both PIs and IMIDs survive only ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K16/28C12N15/13C07K19/00C12N15/867C12N5/10A61K39/00A61P35/00
CPCC07K16/2878C07K14/7051C07K14/70517C07K14/70578C12N5/0636C12N15/86A61K39/001117A61P35/00C07K2317/565C07K2317/56C07K2317/567C07K2317/569C07K2319/02C07K2319/03C07K2319/33C07K2319/74C12N2740/15043C12N2800/107C12N2510/00A61K2039/5156A61K2039/804
Inventor 余学军狄升蒙侯莉何薇潘傅晶
Owner HUADAO SHANGHAI BIOPHARMA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap