A drug for treating acute myocardial infarction
A technology for acute myocardial infarction and drugs, applied in the field of cardiovascular disease drugs, can solve problems such as unclear related mechanisms
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Design and validation of LOC101928034 overexpression plasmid
[0024] (1) According to the RNA nucleic acid sequence NR_125947.1 of LOC101928034, SEQ ID NO.1 and the EcoR I and Xho I restriction sites of pcDNA3.1, primers were designed to construct the pcDNA3.1-LOC101928034 overexpression plasmid. The primer sequences are as follows;
[0025] Upstream primer: GAATTCACACAACTCACCAAACCA, SEQ ID NO.2
[0026] Downstream primer: CTCGAGCCGCACAAACCTATGAGG, SEQ ID NO.3
[0027] (2) Human cardiomyocytes AC16 were inoculated in 6-well plates. When the cell density reached 80%, the cells were transfected with lip2000 liposomes. The control group was transfected with pcDNA3.1, and the experimental group was transfected with pcDNA3.1- LOC101928034, set 3 repetitions for each group;
[0028] (3) After 48 hours of transfection, the medium was discarded, and each well was washed twice with 2ml PBS. After discarding the PBS, 1ml Trizol was added for 10 minutes;
[0029] (4) After pip...
Embodiment 2
[0068] Overexpression of LOC101928034 promotes the proliferation of cardiomyocytes
[0069] (1) Prepare human cardiomyocytes AC16 transfected with pcDNA3.1 and pcDNA3.1-LOC101928034 into a cell suspension, and adjust the cell density to 50,000 / ml;
[0070] (2) Inoculate 100ul of cell suspension in a 96-well plate, set 5 duplicate wells for each group, place in a cell culture incubator, and culture for 48 hours;
[0071] (3) After the incubation, use MTT to detect the absorbance at 570nm.
[0072] Experimental results such as figure 2 As shown, the absorbance value of the pcDNA3.1 group is 0.409±0.036, and the absorbance value of the pcDNA3.1-LOC101928034 group is 0.590±0.033. From the above results, it can be seen that the overexpression of LOC101928034 can effectively promote the proliferation of cardiomyocytes.
Embodiment 3
[0074] Overexpression of LOC101928034 promotes angiogenesis of vascular endothelial cells
[0075] (1) Take Matrigel out of the -20°C refrigerator and put it in a 4°C refrigerator to melt overnight. On the next day, add 40ul of Matrigel into the pre-cooled 96-well plate, and gently shake and tile;
[0076] (2) Prepare the vascular endothelial cells HUVEC transfected with pcDNA3.1 and pcDNA3.1-LOC101928034 into a cell suspension, and add 2×10 4 cells;
[0077] (3) Place the 96-well plate in a cell culture incubator at 37°C, take pictures after culturing for 4 hours, and calculate the total branch length.
[0078] Experimental results such as image 3 As shown, it can be seen from the figure that the overexpression of LOC101928034 can effectively promote the angiogenesis of vascular endothelial cells (the relative fold is 1.399±0.144).
PUM
Property | Measurement | Unit |
---|---|---|
absorbance | aaaaa | aaaaa |
absorbance | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com