Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for covalently linking protein or peptide to nucleic acid

A technology of covalent connection and nucleic acid, applied in the field of covalent connection of protein and nucleic acid, which can solve the problems of vulnerable protein or nucleic acid, high randomness and cumbersome operation process.

Active Publication Date: 2021-05-28
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In view of this, the present invention is committed to providing a method for covalently linking proteins or peptides to nucleic acids, which overcomes several commonly used protein-nucleic acid links in the prior art The method has problems such as cumbersome operation process, easily damaged protein or nucleic acid properties, large randomness, and low connection efficiency, and achieves the purpose of stable, efficient, fixed-point, and directional covalently linking the target protein or peptide to the target nucleic acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for covalently linking protein or peptide to nucleic acid
  • Method for covalently linking protein or peptide to nucleic acid
  • Method for covalently linking protein or peptide to nucleic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] Fusion and expression of embodiment 1SPG and Trwc enzyme

[0072] In this example, SPG, (Streptococcus Protein G) was used as the target protein, which was fused and expressed with Trwc enzyme.

[0073] (1) Cloning of fusion protein

[0074] The nucleotide sequences of SPG and Trwc enzyme are artificially synthesized, the nucleotide sequence of SPG is shown in SEQ ID NO:6, and the nucleotide sequence of Trwc enzyme is shown in SEQ ID NO:2.

[0075] In this example, SPG and Trwc enzyme are connected through a flexible linker peptide GGGGS to form a fusion protein, referred to as SPG-Trwc for short, wherein the nucleotide sequence of the fusion protein SPG-Trwc is shown in SEQ ID NO:7.

[0076] (2) Expression and purification of fusion protein

[0077] The gene of the fusion protein SPG-Trwc was cloned into the expression vector PET32a (the protein can be well expressed in various expression vectors and expression hosts, only the expression in Escherichia coli is descri...

Embodiment 2

[0078] The preparation of the complex that embodiment 2SPG forms with nucleic acid

[0079] The fusion protein SPG-Trwc purified in Example 1 and the recognition nucleotide sequence A: ATTGACTTACGCGCACCGAAAGG TGCGTATTGTCT ATAGCCCAGTTTA (SEQ ID NO: 4) was mixed, and magnesium ions with a final concentration of 1 mM were added, and reacted at 37° C. for 30 minutes to obtain the protein-nucleic acid complex SPG-Trwc-nucleic acid.

[0080] The resulting protein-nucleic acid complex SPG-Trwc-nucleic acid is confirmed by SDS-PAGE electrophoresis, and the results are as follows figure 2 shown. figure 2 The channels from left to right in the figure represent respectively: lane 1 is fusion protein control; lane 2 is SPG-Trwc-nucleic acid complex. From figure 2 It can be seen that there is an obvious hysteresis band in channel 2 compared with the control, indicating that the target protein and target nucleic acid in this example have been covalently linked to form a protein-nucleic ...

Embodiment 3

[0081] Fusion and expression of embodiment 3ECFP and Trwc enzyme

[0082] In this example, the fluorescent protein ECFP was used as the target protein, which was fused and expressed with the Trwc protein.

[0083] (1) Cloning of fusion protein: the nucleotide sequence of artificially synthesized ECFP and Trwc protein, the nucleotide sequence of ECFP is shown in SEQ ID NO: 9, and the nucleotide sequence of Trwc enzyme is shown in SEQ ID NO: 2 .

[0084] In this example, ECFP and Trwc enzyme are connected through a flexible linker peptide GGGGS to form a fusion protein, which is referred to as ECFP-Trwc, wherein the nucleotide sequence of the fusion protein ECFP-Trwc is shown in SEQ ID NO:10.

[0085] (2) Expression and purification of the fusion protein: the gene of the fusion protein ECFP-Trwc was cloned into the expression vector PET32a. The constructed expression vector was transformed into Escherichia coli expression strain BL21(DE3), and positive clones were selected. T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for covalently linking protein or peptide with nucleic acid, and relates to the technical field of biological crosslinking. The method for covalently linking the protein or peptide with the nucleic acid comprises the following steps: (1) forming a fusion protein from the target protein or peptide and Trwc enzyme; and (2) catalyzing the target protein or peptide to be covalently connected with the target nucleic acid by using the Trwc enzyme in the fusion protein. By utilizing the property that the Trwc enzyme can identify, shear and connect a specific target nucleic acid sequence and can be covalently connected with the target nucleic acid, the target protein or peptide and the target nucleic acid can be stably, efficiently and directionally covalently connected in a fixed point manner, the reaction condition is mild, the reaction steps are simple and the consumed time is short. The method only requires adding metal ions without introducing any chemical reagent and is suitable for industrial popularization.

Description

technical field [0001] The invention relates to the technical field of biological cross-linking, in particular to a method for covalently linking proteins and nucleic acids. Background technique [0002] Due to the functional diversity of proteins and the programmability of nucleic acids, protein-nucleic acid complexes have been extensively studied in biotechnology. At present, there have been a large number of work reports on the multi-enzyme system constructed on the nucleic acid nanostructure of the protein-nucleic acid complex, solid phase carriers such as protein immobilization on biochips, biomolecular delivery, and high-resolution imaging technologies. [0003] At present, there are mainly the following methods for protein-nucleic acid connection: high affinity between biotin and streptavidin, nickel ion-mediated nitrilotriacetic acid (NTA) and hexahistidine binding, specific antigen Antibody interaction, heterobifunctional crosslinker-mediated, aptamer-protein-media...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/00C12N15/11C07K19/00
CPCC07K19/00C07K14/00C12N15/11C12N9/12C07K2319/00
Inventor 门冬张先恩周昆曹姗姗周娟
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com