Detection method and kit for lung cancer gene mutation sites

A detection kit and detection method technology, applied in the biological field, can solve problems such as reducing detection sensitivity

Pending Publication Date: 2021-06-04
NANJING PREGENE BIOTECHNOLOGY CO LTD
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Testing performed in multiple reaction systems leads to dilution of clinical samples from the same patient, ultimately reducing the sensitivity of the test

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method and kit for lung cancer gene mutation sites
  • Detection method and kit for lung cancer gene mutation sites
  • Detection method and kit for lung cancer gene mutation sites

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1. A detection method and kit for lung cancer gene mutation sites

[0030] This embodiment mainly describes a detection method and kit for a lung cancer gene mutation site, which includes the following detection steps:

[0031] Enrolled cases: The inventor conducted a study on patients with pulmonary nodules who visited the Thoracic Surgery Department of Shanghai Zhongshan Hospital from January 2017 to December 2017. According to chest CT and blood lung cancer tumor indicators (including EGFR, KRAS, BRAF, HER2, MET ) examination results, it is impossible to determine whether it is lung cancer or benign lung disease. All patients chose to receive surgical treatment, and 10ml of peripheral venous blood was collected before the operation. According to the postoperative pathological results of the tumor, the samples were divided into lung cancer and lung benign disease groups (lung benign diseases include inflammatory pseudotumor, sclerosing hemangioma, tuberculosis...

Embodiment 2

[0073] Example 2. A detection method and kit for lung cancer gene mutation sites

[0074] This embodiment mainly describes a detection method and kit for a lung cancer gene mutation site. The difference from Example 1 is that for the primer connection nucleotide sequence shown in Table 1 and Table 2 "GGGUUGGGAAGAAACUGUGGCACUUCGGUGCCAGCAACCC (SEQ ID NO.398)", to obtain the ligated nucleotide sequence, pretreat the ligated nucleotide sequence, the specific method is: add the ligated nucleotide sequence to buffer B1 and heat to 65°C, Incubate for 10 minutes, then cool to 0°C, and incubate for 20 minutes to obtain the full-length nucleotide sequence for detection; among them, the components of buffer B1 are: 295mM NaC1, 3.5mM MgC1 2 , 15mM Tris (pH 7.6).

[0075] After the digital PCR amplification is completed, the effective fluorescent positive points of the two channels are interpreted by computer analysis, and the results are analyzed. Comparing this embodiment with the cons...

Embodiment 3

[0076] Example 3. A detection method and kit for lung cancer gene mutation sites

[0077] This embodiment mainly describes a detection method and kit for a lung cancer gene mutation site. The difference from Example 1 is that for the primer connection nucleotide sequence shown in Table 1 and Table 2 "GGGUUGGGAAGAAACUGUGGCACUUCGGUGCCAGCAACCC (SEQ ID NO.399)", to obtain the ligated nucleotide sequence, pretreat the ligated nucleotide sequence, the specific method is: add the ligated nucleotide sequence to buffer B1 and heat to 85°C, Incubate for 5 minutes, then cool to 40°C, and incubate for 30 minutes to obtain the full-length nucleotide sequence for detection; the components of buffer B1 are: 305mM NaC1, 5.5mM MgC1 2 , 25mM Tris (pH 7.6).

[0078]After the digital PCR amplification is completed, the effective fluorescent positive points of the two channels are interpreted by computer analysis, and the results are analyzed. By comparing this embodiment with the results of exi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a detection method and kit for lung cancer gene mutation sites. The detection method comprises the following steps: firstly, preparing a digital PCR mixed solution, wherein the digital PCR mixed solution does not contain cytosine triphosphate deoxynucleotide, and a primer used in digital PCR mixed solution contains a nucleic acid sequence N with not less than 13 basic groups; secondly, performing a PCR amplification reaction by using the digital PCR mixed solution to obtain a product after the PCR amplification reaction; and finally, according to the type of fluorescence signals, judging whether a to-be-detected sample contains a DNA template with the site mutation of the target gene or not, and the number and mutation abundance of the DNA template. The unique ultra-multiplex digital PCR technology greatly improves the information flux of tumor gene detection, 99 heavy sites can be amplified in two reaction systems, the problem that the sensitivity is reduced due to sample branching is avoided, and meanwhile, the clinical significance of detection is greatly improved due to the increase of the number of detection sites.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for detecting mutation sites of lung cancer genes and a kit thereof. Background technique [0002] Traditional PCR techniques are prone to non-specific amplification. In order to avoid the impact of non-specific amplification on the signal-to-noise ratio and specificity of the results, the number of amplification multiples in the current PCR system is limited to less than 10. At present, there are nearly a thousand tumor mutation sites that need to be detected clinically, and the NGS platform is almost the main one. Current PCR-based tumor gene detection products only cover a small number of sites due to the limitation of amplification multiples, and need to be completed in multiple reaction systems (for example, Aide Biotech needs to use 12 reaction systems). Testing in multiple reaction systems leads to dilution of clinical samples from the same patient, ulti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6886C12Q1/6851
CPCC12Q1/6886C12Q1/6851C12Q2600/156C12Q2600/16C12Q2531/113C12Q2537/143C12Q2563/107
Inventor尚午张毅良
OwnerNANJING PREGENE BIOTECHNOLOGY CO LTD