Method for biosynthesizing droxidopa based on L-threonine aldolase

A technology for threonine aldolase and biosynthesis, which is applied in the field of biosynthesis of droxidopa based on L-threonine aldolase, can solve the problems of high resolution cost and many by-products, and achieves environmental friendliness. High, low by-products, mild conditions

Pending Publication Date: 2021-06-11
NANJING UNIV OF TECH
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Aiming at the deficiencies in the prior art, the present invention provides a method for biosynthesizing droxidopa based on L-threonine aldolase, the method has mild reaction conditions, is easy to control, and has low cost, avoiding side effects in the chemical synthesis process. The problem of many products and high disassembly cost reduces its preparation cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for biosynthesizing droxidopa based on L-threonine aldolase
  • Method for biosynthesizing droxidopa based on L-threonine aldolase
  • Method for biosynthesizing droxidopa based on L-threonine aldolase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Expression and catalysis of E. coli source L-threonine aldehyde enzyme

[0038] Step 1, extract the genome of E. coli MG1655

[0039] Pick E. coli MG1655 single colony, inoculated in LB medium, cultured at 37 ° C for 12 hours, collected E. coli cells, using bacterial genome DNA extraction kits (DP302) (Tiangen Endochemical Co., Ltd.) followed by the specification Escherichia coli genome.

[0040] Step 2, construct a genetic engineering bacterium BL21 (DE3) / PET28A-LTA expressed in LTA

[0041] Design upstream primers (as shown in SEQ No.4) with BamHI enzyme cleavage: cgcgggatcatgattgattacgcagtg

[0042] Design downstream primers with HindIIs enzyme disaster (as shown in SEQ No.5): cccaagcttacgcccaggaatgcacgcc

[0043]The genomic DNA of E. coli MG1655 was used as a template to obtain a fragment LTA by PCR, and the plasmid tensile cartridge (DP103) (Tiangen Endochemical Co., Ltd.) will be extracted in PET28a plasmid in E. coli T1. Select the enzyme digestion BamH I...

Embodiment 2

[0053] Example 2 Expression and catalysis of L-threonine aldehyde enzymes from copper green pseudocene

[0054] Step 1, build the genetic engineering BL21 (DE3) / PET28A-ITAE expressing ITAE

[0055] The sequence such as SEQ No. 1 is based on the amino acid sequence of the reported copper greecettocellular bacillus L-threonic aldehyde enzyme.

[0056] ATGACCGATCACACCCAACAGTTCGCCAGCGACAACTATTCCGGCATCTGCCCCGAAGCCTGGGCGGCGATGGCCGAAGCCAACCGCGGCCACGAACGCGCCTATGGCGACGACCAGTGGACCGCGCGTGCTTCGGACTACTTCCGCCAGTTGTTCGAGACCGATTGCGAAGTGTTCTTCGCCTTCAACGGCACCGCCGCCAACTCCCTGGCCCTGGCTGCGCTGTGCCAGAGCTACCACAGCGTGATCTGCTCGGAGACCGCCCACGTCGAGACCGACGAGTGCGGCGCGCCGGAGTTCTTCTCCAATGGCTCCAAGCTGCTGCTGGCGCAGACCGAGGTCGGCAAGCTGACCCCGGCGTCGATCCGCGACATCGCTCTCAAGCGCCAGGATATCCACTATCCGAAGCCGCGCGTGGTGACTCTCACCCAGGCCACCGAGGTCGGCACGGTGTACCGCCCGGACGAGCTGAAGGCGATCAGCGCCACCTGCAAGGAGCTCGGCCTGCACCTGCACATGGACGGCGCGCGCTTCTCCAACGCCTGCGCCTTCCTCGGCTGCTCGCCGGCGGAGCTGAGCTGGAAGGCCGGGGTCGACGTGCTCTGCTTCGGCGGCACCAAGAACGGCATGGCGGTGGGCGA...

Embodiment 3

[0058] Example 3 and Example 4 Different L-threonine aldehyde enzymes were different from Example 2, Example 3 is a source of streptomae (sequence after codon optimization, such as SEQ No. 2:

[0059] GTTAACCCGCCTAAAACCGATGCACGTCGTCATCATGATCCTGAAGTGCGTGGTTTTGCAAGTGATAATTATGCAGGTGCACATCCGGAAGTGCTGGCAGCACTGGCACTGGCAAATGGTGGCCATCAGGTAGCATACGGTGAAGATGATTATACCGAAAATCTGCAGCGTGTTATTCGTAGCCATTTTGGTAGCGGTGCAGAAGCATTTCCTGTTTTTAATGGTACCGGTGCAAATGTTGTTGCTCTGCAGGCCGTTACAGATCGTTGGGGTGCAGTGATTTGTGCCGAAAGCGCACATATTAATGTTGATGAAGGTGGTGCACCGGAACGTATGGGCGGTCTGAAACTGCTGACCGTTCCAACCCCGGATGGTAAACTGACACCGGAACTGATTGATCGCCAGGCATACGGTTGGGATGATGAACATCGTGCGATGCCGCAGGTTGTTAGTATTACCCAGTCCACCGAACTGGGTACCCTGTATACCCCGGATGAAATTCGTGCAGTTTGTGAACATGCACATGCCCATGGTATGAAAGTGCATCTGGATGGTAGCCGTATTGCAAATGCCGCAGCAAGCCTGGATGTCCCGATGCGTACCTTTACCAATGCAGTTGGTGTTGATCTGCTGAGCCTGGGTGGTACCAAAAATGGCGCGCTGTTTGGTGAAGCAGTTGTTGTTCTGAATCAGGATGCAGTTCGTCACATGAAACATCTGCGTAAACTGAGTATGCAGCTGGCAAGCAAAATGCGTTTTGTGTCAGTGCAGCTGGAAGCCCTGCTGGCAAAAGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for biosynthesizing droxidopa based on L-threonine aldolase. The method comprises the following steps: taking BL21DE3 as an original strain; and on the basis of an original strain, an ItaE gene for coding L-threonine aldolase and derived form Pseudomonas aeruginosa, a P-TA gene for coding L-threonine aldolase in Pseudomonas putida, an LTA gene for coding L-threonine aldolase in Escherichia coli, or an STA gene for coding L-threonine aldolase in Streptomyces are overexpressed. Through the above operations to get the engineering bacteria, through the centrifugation of wet cells to collect the reaction to get the yield of droxydopa is 3.3 -4.15g / L. Compared with the prior art, the biosynthesis method disclosed by the invention has the advantages of greenness, high yield, mild conditions and the like, and particularly has few byproducts and high environmental friendliness.

Description

Technical field [0001] The present invention belongs to the preparation of Fucydoba, and is specifically related to a method based on L-threonine aldolase biological synthesis of flexofxia. Background technique [0002] Both DOPS is a new anti-Pavinson's disease for improving gait stranches and upright dizziness caused by Parkinson's disease; improvement by Shy-Drager syndrome or family Dirty hypotension, upright dizziness and fainting caused by amyloid neuropathy; improving blood dialysis patients due to dizziness and fatigue caused by erectic hypog pressure. The method currently preparing the method of Quucca is mainly chemical, facing problems such as multi-product, split separation, so the preparation cost is higher. [0003] L-threonine aldehyde enzyme (TAS) can catalyze different types of aldehyde and alkyl alkaldehyde condensation reaction, forming chlomycin, fluorbennette, methylmycin, adrenaline, and flexion Many active medical materials in many active medicine component...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12P13/04C12N15/70C12N1/21C12N15/60C12R1/19
CPCC12P13/04C12N15/70C12N9/88C12Y401/02005C12N2800/22
Inventor 陈可泉乔荣梅王昕冯娇张琨麦丹丹胡鑫峰
Owner NANJING UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap