Supercharge Your Innovation With Domain-Expert AI Agents!

Primer-probe composition for detecting MYH7 gene mutation and application thereof

A primer-probe and composition technology, applied in the biological field, can solve the problems of limited use and promotion, high price, cumbersome process, etc., and achieve the effects of low cost, simple operation and normal amplification curve.

Active Publication Date: 2021-06-11
DALI UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CN102965428A discloses a sample preparation kit for detecting genetic mutations related to cardiac hypertrophy. The kit adopts the method of capturing probes and then sequencing to detect multiple mutation sites of multiple genes, but the process is very cumbersome , takes a long time and is very expensive, which limits the use and promotion of related products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer-probe composition for detecting MYH7 gene mutation and application thereof
  • Primer-probe composition for detecting MYH7 gene mutation and application thereof
  • Primer-probe composition for detecting MYH7 gene mutation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0104] This embodiment provides a primer probe composition for detecting MYH7 gene mutation, said primer probe composition for detecting MYH7 gene mutation includes real-time fluorescent PCR primers and probes for detecting MYH7 gene mutation site c.2652G>T;

[0105] The real-time fluorescent PCR primers include the nucleotide sequences shown in SEQ ID No.1-2;

[0106] The probes include wild-type MYH7 probes and mutant MYH7 probes;

[0107] The probe of the wild-type MYH7 includes the nucleotide sequence shown in SEQ ID No.3, and the probe of the mutant MYH7 includes the nucleotide sequence shown in SEQ ID No.4;

[0108] SEQ ID No.1: 5'-AGGAGATGGCCTCCATGAAGGAG-3';

[0109] SEQ ID No.2: 5'-TGCAGGGTTGTGGGAAGTGAAG-3';

[0110] SEQ ID No. 3: TGCTGCAGGAGAAGAATGACC;

[0111] SEQ ID No. 4: GCAGGAGAATAATGACCTGCA.

[0112] The probe is a Taqman probe, the 5' end of the Taqman probe is marked with a fluorescent reporter group, and the 3' end is marked with a quenching group.

[01...

Embodiment 2

[0115] This embodiment provides a kit for detecting MYH7 gene mutation, said kit including the primer probe composition for detecting MYH7 gene mutation in Example 1, PCR reaction solution, dyes and quality controls, said PCR reaction solution including DNA polymerase, Mg 2+ buffer, dNTPs and water, the dyes include Rox calibration dyes, and the quality controls include wild-type quality controls, homozygous mutant quality controls and heterozygous mutant quality controls.

[0116] In the present invention, the quality control product is prepared by the following method:

[0117] (1) Genome extraction: use a small genome extraction kit to extract the whole genome of the sample, measure the concentration and OD value after agarose electrophoresis detection, when OD 260 / 280 When it is between 1.8 and 2.0, it can be used as an amplification template;

[0118] (2) Using the extracted genome as a template, and setting a negative control group without adding templates, and perform...

Embodiment 3

[0133] In this example, the performance test of the kit for detecting MYH7 gene mutation constructed in Example 2 was carried out, including construction of amplification curve, construction of standard curve, repeatability verification and specificity verification. The specific experimental steps and results are as follows.

[0134] Construct Amplification Curve

[0135] Using the wild-type quality control product and the homozygous mutant quality control product as templates, the templates were diluted 10 times, and the amplification curve was expanded using the kit for detecting MYH7 gene mutations constructed in Example 2.

[0136] The expanded system is as follows:

[0137]

[0138] The amplification procedure is as follows:

[0139] Pre-denaturation: 95°C, 30s;

[0140] Cycle amplification: 95°C, 5s; 57°C, 34s; cycle 45 times;

[0141] Extension: 60°C, 2min.

[0142] The amplification curve of the wild-type quality control product is as follows: Figure 3A As sho...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer probe composition for detecting MYH7 gene mutation and application thereof. The primer-probe composition for detecting MYH7 gene mutation comprises a real-time fluorescent PCR (Polymerase Chain Reaction) primer used for detecting an MYH7 gene mutation site c.2652G>T and a probe. The real-time fluorescent PCR primer comprises nucleotide sequences as shown in SEQ ID No. 1 to SEQ ID No. 2. The probe comprises a wild type MYH7 probe and a mutant type MYH7 probe. The wild type MYH7 probe comprises a nucleotide sequence as shown in SEQ ID No.3, and the mutant type MYH7 probe comprises a nucleotide sequence as shown in SEQ ID No.4. The probe is a Taqman probe, the 5' end of the Taqman probe is marked with a fluorescence reporter group, and the 3' end of the Taqman probe is marked with a quenching group. The primer-probe composition is high in sensitivity, good in specificity and high in application value.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a primer probe composition for detecting MYH7 gene mutation and its application. Background technique [0002] Hypertrophic cardiomyopathy (HCM) is the most common hereditary heart disease, mainly manifested as asymmetric hypertrophy of the left ventricle or biventricular, and a small number of patients present with left ventricular outflow tract obstruction, the main pathological feature is cardiomyocytes Diffuse hypertrophy, deformity, nuclear enlargement, deep staining, and myocardial fiber disorder. The clinical manifestations of HCM gradually develop from no symptoms to dyspnea, syncope, chest pain and even sudden cardiac death and fatal arrhythmia. [0003] The pathogenic genes of HCM mainly include sarcomere protein gene and energy metabolism gene. Mutations in these genes will eventually lead to insufficient energy supply of cardiomyocytes, impairment of cardiac structure an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
CPCC12Q1/6883C12Q1/6858C12Q2600/156C12Q2531/113C12Q2563/107C12Q2561/101
Inventor 赵跃王玉鑫
Owner DALI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com