Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of antibody against B cell maturation antigen and its application

A technology of B cells and chimeric antigen receptors, applied in the field of biomedicine, can solve the problems of insufficient clinical data and achieve the effect of improving the killing ability

Active Publication Date: 2022-07-29
HUADAO SHANGHAI BIOPHARMA CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Antibodies show some potential in the treatment of myeloma, but there is not yet enough clinical data to prove it

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of antibody against B cell maturation antigen and its application
  • A kind of antibody against B cell maturation antigen and its application
  • A kind of antibody against B cell maturation antigen and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] This example is used for the construction and panning of phage nanobody library, and ELISA is used for preliminary screening. Specific steps are as follows:

[0063] (1) Construction of phage nanobody library

[0064] Bactrian camels were immunized with BCMA-Fc expressing the extracellular domain, and after ELISA was used to verify the titer, 200 mL of peripheral blood was drawn; lymphocytes were sorted to obtain peripheral blood mononuclear lymphocyte precipitates, and RNA was extracted; III reverse transcriptase uses RNA as a template to synthesize the first-strand cDNA, and then uses nested PCR to amplify the VHH gene; insert the VHH gene into the pMECS phage display vector, and electrotransform TG1 competent cells, and take an appropriate amount of bacterial broth for library identification , all the remaining cultures are evenly spread on the LB / AMPGLU plate. After the bacteria grow, the bacterial lawn is collected, and 1 / 3 volume of 50% glycerol is added, mixed ...

Embodiment 2

[0078] In this example, the candidate clones were screened by flow cytometry (Fluorescence activated CellSorting, FACS).

[0079] Cells were cultured according to standard cell culture protocols, and cells were digested with trypsin to prepare BCMA-positive and negative cell suspensions; centrifuged at 300 g for 5 min to remove the culture medium, and resuspended cells in Flow Buffer to 2×10 6 cells / mL; add 2 x 10 to each well in a V-bottom 96-well plate 5 Cells were centrifuged at 300g for 5min, the supernatant was removed, the crude VHH antibody extract was added to resuspend the cells, and the cells were incubated at 4°C for 1h;

[0080] After centrifuging at 300 g for 5 min, remove the supernatant, resuspend the cells in Flow Buffer, dilute APCanti-his antibody to 2 μg / mL with Flow Buffer, resuspend cells in 100 μL per well, and incubate at 4°C for 1 h; wash cells with Flow Buffer for 3 times and then use 200 μL Flow Buffer Cells were resuspended and analyzed by flow cyto...

Embodiment 3

[0082]In this example, the VHH-mIgG2a Fc antibody was expressed and purified, and the antibody affinity was determined. In order to further identify the antibodies obtained by screening, the antibodies need to be expressed by mammalian cells. Therefore, a plasmid vector expressing VHH with a mouse Fc tag was constructed first, which is denoted as C-4pCP.Stuffer-mCg2a-FC. The specific steps are as follows:

[0083] 1. Amplify BCMA VHH B21 by PCR with primers:

[0084] HD-F (SEQ ID NO. 10):

[0085] CGCGATTCTTAAGGGTGTCCAGTGCGAGGTTGCAGCTGGTGGA;

[0086] HD-B8-R (SEQ ID NO. 11):

[0087] GCATGGAGGACAGGGCTTGATTGTGGGGCTACTCACTGTCACCTG

[0088] The reaction system is shown in Table 2, and the amplification procedure is shown in Table 3 below:

[0089] Table 2

[0090]

[0091] table 3

[0092]

[0093] 2. The digestion system is shown in Table 4. The digestion temperature is 37°C and the time is 6h. The PCR purification kit was used for purification, and the recovered ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides an antibody against B cell maturation antigen and its application. The antibody of described anti-B cell maturation antigen is BCMA-21, and its heavy chain variable region includes: complementarity determining region 1 shown in SEQ ID NO.1, complementarity determining region 2 shown in SEQ ID NO.2 and SEQ ID NO.2 Complementarity determining region 3 shown in NO.3. In the present invention, the antibody screened by the phage display nanobody library has a specific CDR region, and the obtained antibody can specifically bind to the BCMA antigen with good affinity, and its K a (1 / Ms) is 7.48E+06, K d (1 / s) for 8.50E‑04, K D (M) is 1.14E-10, which is used as an antigen-binding domain to construct chimeric antigen receptors and CAR-T cells, which have obvious killing activity to BCMA-positive tumor cells.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to an anti-B cell mature antigen antibody and its application. Background technique [0002] Multiple myeloma (MM) is a malignant plasma cell disease in which tumor cells originate from plasma cells in the bone marrow, which are cells that develop B lymphocytes to their final functional stages. Therefore, multiple myeloma can be classified as B lymphocytic lymphoma. It is characterized by abnormal proliferation of bone marrow plasma cells with overproduction of monoclonal immunoglobulins or light chains (M protein) and, in rare cases, unsecreted MM that does not produce M protein. Multiple myeloma is often accompanied by multiple osteolytic lesions, hypercalcemia, anemia, and kidney damage. Various bacterial infections are prone to occur because the production of normal immunoglobulins is inhibited. [0003] Antibodies have shown some potential in the treatment of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/28C12N15/13C07K19/00C12N15/867C12N5/10A61K39/00A61P35/00
CPCC07K16/2878C07K14/7051C07K14/70517C07K14/70578C12N5/0636C12N15/86A61K39/001117A61P35/00C07K2317/565C07K2317/56C07K2317/567C07K2319/02C07K2319/03C07K2319/33C07K2319/74C12N2740/15043C12N2800/107C12N2510/00A61K2039/5156A61K2039/804
Inventor 余学军狄升蒙石磊郑真真
Owner HUADAO SHANGHAI BIOPHARMA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com