Sequence for increasing translation start sites of gram-positive bacteria and application of sequence in improving protein expression efficiency

A technology of Gram-positive bacteria and starting sites, which is applied in the fields of genetic engineering and microbial engineering, and can solve the problems of insignificant improvement

CN113106095AActive Publication Date: 2021-07-13HUBEI UNIV
5 Cites 1 Cited by

Patent Information

Authority / Receiving Office
CN · China
Current Assignee / Owner
Publication Date
2021-07-13

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention belongs to the technical field of genetic engineering and microbiological engineering, and discloses a sequence for increasing translation start sites of gram-positive bacteria and application of the sequence in improvement of protein expression efficiency, and the sequence is shown as SEQ ID NO.1. According to the invention, a 5' untranslated region of the promoter is transformed, so that a target gene is prompted to translate from a plurality of translation start sites. In bacillus licheniformis and bacillus subtilis, the expression quantities of green fluorescent protein are respectively increased by about 150 times and 126 times compared with the original promoter P43. In corynebacterium glutamicum, the expression quantity of green fluorescent protein is increased by 36 times compared with that of an original promoter. Meanwhile, the mRNA leader sequence also remarkably improves the expression quantity of keratinase in bacillus licheniformis, and proves that the mRNA leader sequence is universal for improving the protein expression efficiency of gram-positive bacteria.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention relates to the technical fields of genetic engineering and microbial engineering, in particular to the sequence used to increase the translation initiation site of Gram-positive bacteria and its application in improving protein expression efficiency. Background technique

[0002] Bacillus licheniformis, Bacillus subtilis and Corynebacterium glutamicum are generally recognized as safe (GRAS) Gram-positive bacteria. They are extremely important industrial microbial production strains due to their biosafety, ability to produce a variety of valuable metabolites, and ease of genetic modification. At present, researchers have taken a series of optimization measures for each stage of protein expression of these strains to improve the expression efficiency of heterologous proteins, including promoter optimization, signal peptide screening, protease knockout, etc.

[0003] The 5' untranslated region (5'-UTR) of prokaryotic mRNA usually contains r...

Examples

Embodiment 1

[0031] The construction of the expression green fluorescent protein (GFP) vector applicable to the 5'-UTR single copy RBS of Bacillus licheniformis and Bacillus subtilis:

[0032] For Bacillus licheniformis and Bacillus subtilis, the gene expression vector is designed based on pHY300PLK:

[0033] 1. According to the Bacillus subtilis (B.subtilis) 168 genome sequence NZ_CP010052.1 released by the NCBI database, find the original sequence of P43, use the Primer Primer 5 software to design primers P43-F and P43-R, and use the total DNA of B.subtilis 168 as The original promoter P43 was amplified from the template, and its 5'-UTR original sequence was GTGATAGCGGTACCATTATAGGTAAGAGAGGAATGTACAC; the primers were designed as follows:

[0034] P43-F: GCGGAATTTCCAATTTCA

[0035] P43-R: GTGTACATTCCTCTCTTACCTATAA

[0036]2. Using the promoter P43 amplified in step 1 as a template, use Primer Primer5 software to design primers P43-F and P43-repeat-R, and change the 5'-UTR region of the P...

Embodiment 2

[0057] Construction of expression green fluorescent protein (GFP) vectors suitable for Bacillus licheniformis and Bacillus subtilis:

[0058] The multi-copy RBS expression vector is designed with A1-repeat1-GFP:

[0059] 1. Using A1-repeat1-GFP as a template, design primers at the 5'-UTR position. The forward primer GFP-repeat-F contains the 18nt bases at the end of the 5'-UTR of the single-copy plasmid and the 18nt bases at the 5'-end of the GFP gene, and the reverse primer GFP-repeat-R is the reverse primer of two copies of the 5'-UTR. to the sequence;

[0060] Primers were designed as follows:

[0061] GFP-repeat-F: AGAAAGGAGGAAGGATCAATGGTCAGCAAAGGCGAA

[0062] GFP-repeat-R: TGATCCTTCCTCCTTTCTAGATCTGCTCACTGATCCTTCCTCCTTTTCT

[0063] 2. Carry out PCR reaction on the single-copy plasmid A1-repeat1-GFP through the designed primers. The principle of multi-copy amplification is because the GFP-repeat-R primer is a double-copy primer that can bridge from head to tail and cont...

Embodiment 3

[0072] The construction of the expression green fluorescent protein (GFP) vector applicable to the 5'-UTR single copy RBS of Corynebacterium glutamicum 13032:

[0073] For Corynebacterium glutamicum 13032, the gene expression vector was designed based on the commercial vector pEC-XK99E: 1. Using the promoter P of the pEC-XK99E vector trc (excluding the UTR sequence region) and the terminator rrnB T1terminator region are used as the promoter and terminator sequence of this implementation, and the primer pEC-T5-F / R is designed to linearize the vector pEC-XK99E by PCR, and the PCR product is recovered and purified;

[0074] Primers were designed as follows:

[0075] pEC-T5-F:ACACATTATACGAGCCGGAT

[0076] pEC-T5-R: CTGCAGGTCGACTCTAGATTATTTACAGTTCATCCA

[0077] 2. Design the amplification primers for the reporter protein green fluorescent protein (GFP), use the Primer Primer 5 software to design primers GFP-F and GFP-R, and amplify the 5'-UTR single copy RBS green derived from A1...