Preparation and application of Tn5 mutant enzyme
A mutant and mutant technology, applied in DNA preparation, biochemical equipment and methods, enzymes, etc., can solve problems such as restriction fragmentation reaction, and achieve the effects of not easy to degrade, improve activity, and enhance stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Embodiment 1: the preparation of mutant Tn5 transposase
[0026] 1. Construct the vector containing the nucleotide sequence encoding the mutant Tn5 transposase
[0027] (1) Delete amino acids 2-6 and amino acids 373-391 of the N-terminal of E54K, L372P Tn5 transposase and mutate alanine at position 466 to cysteine. Using the method of gene synthesis, synthesize the nucleotide sequence of mutant Tn5 transposase (comprising mutant Tn5 transposase, intein and chitin binding domain), and connect to NdeI and BamHI restriction sites of pTXB1 vector In the middle, a complete plasmid is formed.
[0028] (2) Take 20 ul of the ligated product, add 100 ul of BL21(DE3) competent E. coli, gently flick the tube wall several times, and place the tube on ice for 30 min. Heat shock at 42°C for 90s, then cool on ice for 2min. Add 900ul of SOC medium to the tube and shake the bacteria at 37°C for 1h. Take 100ul bacterial liquid and spread it on the plate containing ampicillin. Invert...
Embodiment 2
[0033] Example 2: Comparison of properties of mutant Tn5 transposase and E54K, L372P transposase
[0034] (1) Construction of fragmented DNA library
[0035] Prepare a treatment system using genomic DNA as a template, the reaction system is as follows: 25mM Tris-HCl pH=8.5, 5mM MgCl 2 , 200 nM of the mutant Tn5 transposase obtained in Example 1, 100 ng of genomic DNA, 1 ng of an adapter primer containing a 19 bp transposon sequence; reaction conditions: 55° C., 7 min.
[0036] The primer containing the 19bp transposon linker includes: a transposase recognition sequence, a first linker sequence; a second linker sequence.
[0037] Transposase recognition sequence: AGATGTGTATAAGAGACAG;
[0038] The first linker sequence (XXXXXX represents the Index sequence):
[0039] AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATCT;
[0040] The second linker sequence (XXXXXX represents the Index sequence):
[0041] CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGTGCTC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


