Unlock instant, AI-driven research and patent intelligence for your innovation.

Exosome containing CD10-dm protein as well as preparation method and application of exosome

A technology of cd10-dm and exosomes, which is applied in the field of cell biology, can solve the problems that the targeting mechanism is not yet understood, and cannot be selectively used, so as to achieve the effect of increasing the content

Pending Publication Date: 2021-08-06
SOUTHWEST MEDICAL UNIVERISTY
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Exosomes from natural sources have a certain degree of targeting, but the targeting mechanism has not yet been understood, so they cannot be selectively used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Exosome containing CD10-dm protein as well as preparation method and application of exosome
  • Exosome containing CD10-dm protein as well as preparation method and application of exosome
  • Exosome containing CD10-dm protein as well as preparation method and application of exosome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0108] (1) Prepare HeLa cells overexpressing CD10-dm and RVG-LAMP2b genes;

[0109] A. pLVX-IRES-ZsGreen1-RVG-LAMP2b plasmid construction:

[0110] A1, the DNA coding sequence of the artificially synthesized RVG short peptide; the protein sequence of the RVG short peptide is YTIWMPENPRPGTPCDIFTNSRGKRASNG,

[0111] The corresponding cDNA sequence (SEQ ID NO.1) is:

[0112] TATACCATTTGGATGCCGGAAAACCCGCGCCCGGGCACCCCGTGCGATATTTTTACCAACAGCCGCGGCAAACGCGCGAGCAACGGC.

[0113] The template for overlapping PCR is Human LAMP2b cDNA (NCBI Reference Sequence: NM_013995.2)

[0114] A2, the DNA coding sequence of the RVG short peptide is fused in-frame to the end of the LAMP2b cDNA signal peptide sequence to obtain the RVG-LAMP2b fusion gene sequence;

[0115] The RVG cDNA was cloned between the 31st and 32nd amino acids of LAMP2b by overlapping PCR technique to form the RVG-LAMP2b fusion gene. The primers used are: upstream outer primer UpXho, downstream outer primer DnBam, upstream ove...

Embodiment 2

[0140] (1) Prepare HeLa cells overexpressing CD10-dm and RVG-LAMP2b genes, as in Example 1;

[0141] (2) HeLa cells overexpressing CD10-dm and RVG-LAMP2b genes were cultured in serum-free DMEM, and after the culture was completed, the culture fluid was collected;

[0142]After the transfected HeLa cells obtained in step C were cultured for 10 h, they were replaced with DMEM serum-free medium for culture, and the culture was continued for 36 h to complete the culture.

[0143] (3) Separating and purifying the culture medium collected in step (2) to obtain exosomes containing CD10-dm and displaying RVG short peptides on the surface.

[0144] a. Centrifuge the culture solution at 4°C and 200 g for 10 minutes, and take the supernatant for later use;

[0145] b. Centrifuge the supernatant obtained in a at 4°C and 3000 g for 10 min, and take the supernatant for later use;

[0146] c. Centrifuge the supernatant obtained in b at 4°C and 10,000 g for 30 min, and take the supernatant ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of cell biology, in particular to an exosome containing CD10-dm protein and capable of targeting brain tissues as well as a preparation method and application of the exosome. The exosome is loaded with CD10 protein with enhanced enzymatic activity and specificity, and RVG oligopeptide which can be combined with a brain nerve cell acetylcholine receptor in a targeted manner is shown on the surface of the exosome. After intravenous administration, the exosome can penetrate through a blood brain barrier and is specifically combined with positive nerve cells of an acetylcholine receptor, so that the CD10-dm protein is delivered into the nerve cells, A beta protein causing the Alzheimer's disease is efficiently and specifically degraded, the expression of anti-inflammatory genes is enhanced, and the expression of pro-inflammatory genes is inhibited. In addition, the exosome is compatible with recipient cells, does not cause immune response and inflammatory response of receptors, can significantly reduce toxic and side effects of gene therapy, and has a positive effect on treatment of the Alzheimer's disease.

Description

technical field [0001] The present invention relates to the field of cell biology, in particular to an exosome loaded with CD10-dm protein and capable of targeting brain tissue, its preparation method and application. Background technique [0002] Alzheimer's Disease (AD) is a neurodegenerative disease that seriously threatens human health. Exploring safe and efficient treatment options is a hot spot in medical research. Neprilysin (CD10) is a zinc-dependent metalloprotease widely expressed in various cells. CD10 can cleave proteins at the amino terminus of hydrophobic amino acids, thereby inactivating a variety of peptide hormones. CD10 also cleaves the Aβ protein that causes Alzheimer's disease. After CD10 is introduced into the G399V / G714K double mutation (CD10-dm) through genetic engineering, its activity can be increased by 20 times, and the activity of cutting peptide hormones can be reduced by 3200 times, thus greatly improving the activity and specificity of CD10 c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/62C12N15/57C12N15/867A61K47/46A61K47/18A61K38/43A61K48/00A61P25/28A61K49/00
CPCC12N5/0682C12N9/6494C12N15/86A61K47/46A61K47/183A61K38/43A61K48/005A61K48/0008A61P25/28A61K49/0047A61K49/005A61K49/0052C12Y304/24011C07K2319/33C12N2740/15043C12N2510/00
Inventor 党喜同毛亮周锐
Owner SOUTHWEST MEDICAL UNIVERISTY