Exosome containing CD10-dm protein as well as preparation method and application of exosome
A technology of cd10-dm and exosomes, which is applied in the field of cell biology, can solve the problems that the targeting mechanism is not yet understood, and cannot be selectively used, so as to achieve the effect of increasing the content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0108] (1) Prepare HeLa cells overexpressing CD10-dm and RVG-LAMP2b genes;
[0109] A. pLVX-IRES-ZsGreen1-RVG-LAMP2b plasmid construction:
[0110] A1, the DNA coding sequence of the artificially synthesized RVG short peptide; the protein sequence of the RVG short peptide is YTIWMPENPRPGTPCDIFTNSRGKRASNG,
[0111] The corresponding cDNA sequence (SEQ ID NO.1) is:
[0112] TATACCATTTGGATGCCGGAAAACCCGCGCCCGGGCACCCCGTGCGATATTTTTACCAACAGCCGCGGCAAACGCGCGAGCAACGGC.
[0113] The template for overlapping PCR is Human LAMP2b cDNA (NCBI Reference Sequence: NM_013995.2)
[0114] A2, the DNA coding sequence of the RVG short peptide is fused in-frame to the end of the LAMP2b cDNA signal peptide sequence to obtain the RVG-LAMP2b fusion gene sequence;
[0115] The RVG cDNA was cloned between the 31st and 32nd amino acids of LAMP2b by overlapping PCR technique to form the RVG-LAMP2b fusion gene. The primers used are: upstream outer primer UpXho, downstream outer primer DnBam, upstream ove...
Embodiment 2
[0140] (1) Prepare HeLa cells overexpressing CD10-dm and RVG-LAMP2b genes, as in Example 1;
[0141] (2) HeLa cells overexpressing CD10-dm and RVG-LAMP2b genes were cultured in serum-free DMEM, and after the culture was completed, the culture fluid was collected;
[0142]After the transfected HeLa cells obtained in step C were cultured for 10 h, they were replaced with DMEM serum-free medium for culture, and the culture was continued for 36 h to complete the culture.
[0143] (3) Separating and purifying the culture medium collected in step (2) to obtain exosomes containing CD10-dm and displaying RVG short peptides on the surface.
[0144] a. Centrifuge the culture solution at 4°C and 200 g for 10 minutes, and take the supernatant for later use;
[0145] b. Centrifuge the supernatant obtained in a at 4°C and 3000 g for 10 min, and take the supernatant for later use;
[0146] c. Centrifuge the supernatant obtained in b at 4°C and 10,000 g for 30 min, and take the supernatant ...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com