Saccharomyces cerevisiae for high-yield production of hydroxytyrosol and construction method thereof

A technology of Saccharomyces cerevisiae and hydroxytyrosol, which is applied in the field of Saccharomyces cerevisiae and its construction with high production of hydroxytyrosol, can solve the problems of low efficiency and achieve the effect of increasing yield

Active Publication Date: 2021-08-13
TIANJIN UNIV
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The prior art adopts 4-hydroxyphenylacetic acid-3-hydroxylase HpaB / riboflavin oxidoreductase HpaC derived from Escherichia coli (Escherichia coil) to convert tyrosol into hydroxytyrosol; but according to the literature "Overproduction ofhydroxytyrosol in According to Saccharomyces cerevisiae by heterologous overexpression of the Escherichia coli 4-hydroxyphenylacetate 3-monooxygenase", the expression of HpaB / HpaC derived from Ec in Saccharomyces cerevisiae, 1mM tyrosol can only be converted into 4.6mg / L hydroxytyrosol, the efficiency is low
Saccharomyces cerevisiae engineered bacteria that can efficiently convert tyrosol into hydroxytyrosol in Saccharomyces cerevisiae have not yet been found

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharomyces cerevisiae for high-yield production of hydroxytyrosol and construction method thereof
  • Saccharomyces cerevisiae for high-yield production of hydroxytyrosol and construction method thereof
  • Saccharomyces cerevisiae for high-yield production of hydroxytyrosol and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1: the construction of the chassis bacterial strain of producing tyrosol

[0045] 1) Using the Saccharomyces cerevisiae CEN.PK2-1C genome as a template, using PCR to amplify the ARO2, ARO10, TKL1, RKI1 gene fragments and ARO4, ARO7, ARO3 fragments; using the Escherichia coli BL21 genome as a template, using PCR to amplify the TyrA fragment;

[0046] 2) Obtain ARO4 by point mutation method K229L , ARO7 G141S , ARO3 D154N mutant;

[0047] 3) Expressing the above-mentioned genes using a constitutive promoter of Saccharomyces cerevisiae, and constructing PRS406 and PRS404 integration plasmids;

[0048] 4) using CRISPR-Cas9 method to knock out PDC1 and PHA2 genes in the above Saccharomyces cerevisiae;

[0049] PDC1-spacer: ATTGGATCTGACTCCTCACG;

[0050] PDC1 homology arm:

[0051] ACAGCAGCAAAATGACGATAGTTCCATAAATATGTATCCCGTGTATGCGTATTTGCCATCCATATCTAAAATTGGCACAATTGAACAACCCTGATAGAAAGGAATCATTTCTGTTGGAAA;

[0052] PHA2-spacer: GGGGGATAGAGGCTGCTGGG;

[0053] PHA...

Embodiment 2

[0057] Example 2: Construction of HpaB and HpaC combination

[0058] 1) Synthesize the coding genes of HpaB and HpaC from different sources by the reagent company, and use this as a template to design upstream and downstream primers (add the sequences of the PDC1p promoter homology arm and the GPM1t terminator homology arm at both ends of the amplification primer, and add TEF1p promoter homology arm and PGK1t terminator homology arm sequence) for PCR amplification. The PCR amplification conditions are as follows:

[0059] Pre-denaturation at 95°C for 10 minutes, followed by 25 cycles at 98°C for 30s, 58°C for 30s, and 72°C for 1min and 30s; finally, extension at 72°C for 5 minutes.

[0060] The above PCR products were recovered by gel, and HpaB-encoding gene fragments from different sources with PDC1p promoter homology arms and GPM1t terminator homology arms were obtained, as well as HpaC encoding with TEF1p promoter homology arms and PGK1t terminator homology arms. Gene fra...

Embodiment 3

[0064] Example 3: Constructing and expressing PaHpaB Q212D mutant Saccharomyces cerevisiae

[0065] 1) Utilize CRISPR-Cas9 to mutate PaHpaB into PaHpaB for the Saccharomyces cerevisiae strain constructed in Example 2 Q212D . The spacer is designed as 5'-TCAAGGTTCTGCTCAATTGT-3', and the homology arm sequence is:

[0066] TTGTTTCTGGTGCTAAGGTTGTTGCTACTAACTCTGCTTTGACTCACTACAACTTCGTTGGTCAAGGTTCTGCTGACCTACTTGGTGACAACACTGACTTCGCTTTGATGTTCATCGCTCCAATGAACACTCCAGGTAT;

[0067] 2) Transfer the Cas9 plasmid and homology arm with the corresponding spacer into a Saccharomyces cerevisiae strain expressing the PaHpaB-HpaC combination, and after colony PCR and genome PCR amplify the PaHpaB sequence, sequence verification that PaHpaB was successfully mutated into PaHpaB Q212D .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of microbial genetic engineering, and discloses saccharomyces cerevisiae for high-yield production of hydroxytyrosol and a construction method thereof. The saccharomyces cerevisiae for high-yield production of hydroxytyrosol expresses HpaB and HpaC with specific sources on the basis of saccharomyces cerevisiae capable of synthesizing hydroxytyrosol, thereby realizing the preparation and high yield of hydroxytyrosol. The invention mainly selects 4-hydroxyphenylacetic acid-3-hydroxylase derived from pseudomonas aeruginosa, and combines with riboflavin oxidoreductase with other specific sources to transfer the 4-hydroxyphenylacetic acid-3-hydroxylase into saccharomyces cerevisiae chassis cells capable of producing hydroxytyrosol, thereby realizing the improvement of the yield of hydroxytyrosol; and on the basis, various modifications are further carried out, so that the yield of hydroxytyrosol of the saccharomyces cerevisiae is up to 1120mg / L, and a new way is provided for the efficient fermentation production of hydroxytyrosol by microorganisms.

Description

technical field [0001] The invention relates to the technical field of microbial genetic engineering, in particular to a Saccharomyces cerevisiae capable of high-yielding hydroxytyrosol and a construction method thereof. Background technique [0002] Hydroxytyrosol (3,4-dihydroxyphenylethanol) is widely used in food, health care products and cosmetics, and has broad market value. The current extraction of hydroxytyrosol from plants is low in yield and complicated in purification. The chemical synthesis of hydroxytyrosol requires expensive catalysts. The production of hydroxytyrosol by microbial fermentation has the advantages of low dependence on nature, no need for expensive catalysts, and relatively easy purification. Therefore, an engineered strain that can produce high hydroxytyrosol has great potential for development. The prior art adopts 4-hydroxyphenylacetic acid-3-hydroxylase HpaB / riboflavin oxidoreductase HpaC derived from Escherichia coli (Escherichia coil) to c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/19C12N15/81C12N15/53C12P7/22C12R1/865
CPCC12N9/0073C12N9/0028C12N15/81C12P7/22C12Y114/14009C12Y105/01041
Inventor罗云孜刘化一
OwnerTIANJIN UNIV