COVID-19 subunit vaccine based on saccharomyces cerevisiae surface display system

A technology of yeast and recombinant yeast, which is applied in the field of antiviral vaccines, can solve the problems of vaccine safety key protein concept stability and immune response level to be further confirmed, and achieve the effect of improving immunity and preventing infection

Pending Publication Date: 2021-08-31
SOUTHWEST JIAOTONG UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although more than ten COVID-19 subunit candidate vaccines have entered clinical trials, the safety of the vaccine, the stability of the concept of key proteins, and the assurance of the level of immune response still need to be further confirmed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • COVID-19 subunit vaccine based on saccharomyces cerevisiae surface display system
  • COVID-19 subunit vaccine based on saccharomyces cerevisiae surface display system
  • COVID-19 subunit vaccine based on saccharomyces cerevisiae surface display system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0080] The construction of embodiment 1 recombinant plasmid pYD1-RBD

[0081] 1. RBD gene amplification

[0082] 1.1 Design of RBD-specific primers

[0083] Using the S gene of SARS-CoV-2 (gene bank number: MN908947) as a DNA template, the RBD gene was amplified by designing specific primers. The primer sequences are shown in Table 1, and the underlines in primers F-1 and R-1 are respectively Restriction sites Nhe I and EcoR I.

[0084] Table 1. PCR primers for RBD gene

[0085]

[0086] The receptor binding domain (RBD) gene sequence (SEQ ID NO.1, 582bp) is as follows:

[0087] ATGCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGC CACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAAC TGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTA AGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAAT GTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCG CTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGAT GATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAA GGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTC...

Embodiment 2

[0123] Example 2, Molecular Construction of Recombinant Yeast EBY100 / pYD1-RBD

[0124] 1. Transformation of recombinant plasmid pYD1-RBD

[0125] (1) Take the EBY100 strain stored in a -80°C ultra-low temperature refrigerator, streak it on the YPD solid medium, place it in an incubator, and cultivate it at 30°C;

[0126] (2) Pick a single colony in 3mL YPD medium and culture at 30°C;

[0127] (3) Measure the absorbance (OD) of EBY100, and transfer the cultured bacterial liquid into 50 mL of fresh YPD culture liquid, adjust the OD value to 0.4, and continue to cultivate for 4-5 hours at 30°C and 200 rpm;

[0128] (4) Centrifuge at 3,000 rpm for 5 minutes at 4°C, wash twice with sterile water;

[0129] (5) Centrifuge at 3,000 rpm for 5 minutes at 4°C, and resuspend the bacteria in 1 mL of 0.1M LiAc;

[0130] (6) Put it on the prepared ice for 10 minutes, centrifuge at 4,000 rpm for 3 minutes, discard the supernatant, resuspend the pellet in 300 μL LiAc, take 2 EP tubes, and d...

Embodiment 3

[0143] Embodiment 3, the preparation of oral vaccine

[0144] (1) Induce expression of recombinant Saccharomyces cerevisiae EBY100 / pYD1-RBD.

[0145] (2) Take the bacterial liquid induced for 72 hours, and measure its absorbance at OD600nm.

[0146] (3) Centrifuge at 5,000 rpm for 15 min at 4°C, discard the supernatant, and rinse the pellet three times with sterilized PBS.

[0147] (4) The bacterium was resuspended in sterilized PBS, and its concentration was adjusted to 1OD600nm / μL, and inactivated in a water bath at 60°C for 1 hour.

[0148] The induction expression method in step (1) is as follows:

[0149] (a) A single colony of EBY100 / pYD1-RBD prepared in Example 2 was picked with a pipette gun, inoculated into 3 mL of culture medium, placed in a vibrating shaker, and cultured at 30° C. and 250 rpm for 16-18 hours.

[0150] (b) Take 1 mL of bacterial liquid to measure the OD600nm value, so that the OD600nm value is between 2.0-5.0.

[0151] (c) In the YNB-CAA liquid m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
adsorption capacityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a COVID-19 subunit vaccine based on a saccharomyces cerevisiae surface display system, and belongs to the field of antiviral vaccines. The vaccine is a novel vaccine obtained by performing fusion expression on a novel coronavirus antigen gene RBD and a lectin receptor Aga2 subunit through the saccharomyces cerevisiae surface display system and displaying the surface antigen RBD of the novel coronavirus on the surface of saccharomyces cerevisiae. The vaccine is safe, effective, quick to prepare and convenient to use, and has a good application prospect in prevention and control of COVID-19 epidemic situation.

Description

technical field [0001] The invention belongs to the field of antiviral vaccines, in particular to a COVID-19 subunit vaccine based on a yeast surface display system. Background technique [0002] Novel coronavirus (SARS-CoV-2, referred to as "new coronavirus") is a large-scale outbreak of infectious coronavirus in humans after SARS-CoV and MERS-CoV, which can cause new coronavirus pneumonia (COVID-19, referred to as "COVID-19"). [0003] The new coronavirus is composed of a double-layer lipid envelope, including Spike glycoprotein (S), envelope protein (Envelope protein, E), membrane protein (Membrane glycoprotein, M) and nucleocapsid protein (Nucleocapsid protein, N). Among them, S protein and N protein are the most important target proteins. The S protein is the "crown" on the surface of the coronavirus, which is located on the outermost layer of the virus and is related to the infectivity of the virus. The S protein contains two functional subunits: S1 and S2, respect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/81C12N15/62C12N1/19A61K39/215A61P31/14C12R1/865
CPCC12N15/81C07K14/005A61K39/12A61P31/14C07K2319/00C12N2800/101C12N2770/20022C12N2770/20034A61K2039/523
Inventor雷涵高彤任怡鲁欣
OwnerSOUTHWEST JIAOTONG UNIV