Method for improving bacterial blight resistance of rice

A technology for resisting bacterial blight and rice, applied in the field of genetic engineering, can solve problems such as unclear molecular mechanism

Active Publication Date: 2021-09-17
SOUTH CHINA AGRI UNIV
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are many studies on the involvement of receptor-like protein kinases in innate immunity in Arabidopsis, but there are few reports on the involvement of receptor-like protein kinases in the disease-resistant immune response in rice, and the molecular mechanism is not clear. The causative factors of the disease still need to be further investigated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving bacterial blight resistance of rice
  • Method for improving bacterial blight resistance of rice
  • Method for improving bacterial blight resistance of rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 OsRLK1 gene editing and vector transformation of wild-type rice Z H11

[0033] 1. Experimental method

[0034] According to the Nipponbare reference sequence design gene editing target sequence 1: GAGGCTGCAAGCCGCAACCA (SEQ ID NO: 3), and target sequence 2: AGAGCACGACGCTCGGCACG (SEQ ID NO: 4); its position is as follows figure 1 As shown in A. First, find the genome sequence of OsRLK1 on the NCBI website (www.ncbi.nlm.nih.gov), then select the above two targets in the genome sequence of OsRLK1, and connect the DNA sequences of the two targets together into the DNA sequence initiated by U6a. sub-promoted Cas9 vector ( figure 2 ) to obtain a dual-target targeting vector.

[0035] Then, the above-mentioned targeting vector was introduced into wild-type rice ZH11 plants through genetic transformation mediated by Agrobacterium EHA105, the transgenic plants were screened by hygromycin, and the transgenic plants were sequenced and identified using primers OsRLK1-F...

Embodiment 2

[0040] Example 2 Detection of ROS and cell death

[0041] 1. Experimental method

[0042] (1) DAB staining: two leaves were taken from the eight-week-old mutant Osrlk1 (L1 and L3) and wild-type ZH11 plants, and quickly inserted into the DAB (pH=3.8) solution with a concentration of 1 mg / mL, and vacuumed for 30 After 5 minutes in the dark at room temperature, the floating color was removed in 95% ethanol after staining. Each genotype used 6 leaves for measurement.

[0043] (2) NBT staining: Take two leaves from mutant Osrlk1 (L1 and L3) and wild-type ZH11 plants of eight weeks seedling age, insert them into 0.1% NBT solution quickly, vacuumize for 30 minutes, and then place them in a dark place at room temperature Let it stand for 3 hours, remove the floating color in 95% ethanol after staining, and use 6 leaves for each genotype for measurement.

[0044] (3) Trypan blue staining: take the inverted two leaves from the eight-week-old mutant Osrlk1 (L1 and L3) and wild-type ZH1...

Embodiment 3

[0047] Embodiment 3 Bacterial blight inoculation experiment

[0048] 1. Experimental method

[0049] Leaf-cut method was used for inoculation, and two strains Xanthomonas oryzae pv.oryzae guangdong 4( image 3 A) and Xanthomonas oryzae pv.oryzae guangdong 5( image 3 B), the cells were cultured in a 28°C incubator for 2 days to become bright yellow, then diluted with PBS solution, and the concentration was diluted to about 9×10 by turbidimetric method. 9 bacteria / mL. (The strains are from the Institute of Plant Protection, Guangdong Academy of Agricultural Sciences), and the mutant Osrlk1 (L1 and L3) and wild-type ZH11 plants were inoculated at the rice booting stage. When inoculating, use scissors to dip in the bacterial solution, cut off the about 2 cm long part of the leaves, and measure the length of the lesion 21 days after inoculation.

[0050] 2. Experimental results

[0051] Such as Figure 4 As shown, Xanthomonas oryzae pv.oryzae guangdong 4( Figure 4 A) The l...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving bacterial blight resistance of rice. A rice OsRLK1 gene is knocked out, or the OsRLK1 gene is inactivated, so that an OsRLK1 protein is inactivated. The invention discloses a new molecular mechanism for regulating and controlling disease resistance of the rice and provides a new method for improving bacterial blight resistance of the rice, a receptor-like kinase gene OsRLK1 in the rice is edited in a targeted manner by utilizing a genome, an immune signal of the rice can be activated, and the disease resistance of the rice is realized.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, and more specifically, relates to a method for improving resistance to bacterial blight of rice. Background technique [0002] Rice is one of the most important food crops in the world and also the main food crop in my country. Rice is affected by about 70 pathogens during its growth, especially viruses, bacteria, fungi, and nematodes. The protein causes tissue damage to the host, severely reducing yield. How to reduce the losses caused by these diseases has always been the focus of rice research. Improving disease resistance by genetically improving disease resistance genes in rice can reduce the use of pesticides and is an environmentally friendly best practice. Developing new disease-resistant varieties to protect rice from pathogens through gene function mining is of great significance for elucidating the molecular mechanism of rice disease resistance and improving rice disease...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82A01H5/00A01H6/46
CPCC12N15/113C12N9/12C12N15/8218C12N15/8281
Inventor刘慧丽朱广琦黄美玲董孟格梁玮陶利珍
OwnerSOUTH CHINA AGRI UNIV