Linear probe and method for detecting miRNA by using same

A probe detection, linear technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of insufficient sensitivity or specificity, long reverse transcription time, etc., to reduce steric hindrance, Fast response and good detection specificity

Active Publication Date: 2021-10-08
刘孟坛
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The object of the present invention is to overcome the deficiencies in the prior art, provide a kind of linear probe and the method for detecting miRNA by

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Linear probe and method for detecting miRNA by using same
  • Linear probe and method for detecting miRNA by using same
  • Linear probe and method for detecting miRNA by using same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] The feasibility of embodiment 1 verification method

[0051] The linear probe of the present invention includes three regions a, b and c. The 3' end of the b region is connected to the 5' end of the a region, the 3' end of the c region is connected to the 5' end of the b region; the nucleotide sequence of the a region is complementary to the target nucleic acid, and the b region The nucleotide sequence assists loop formation by reducing steric hindrance, and the nucleotide sequence of the c region is the same as the 5' end of the target nucleic acid. In this example, miRNA155 is used as the target miRNA (sequence: UUAAUGCUAAUUGUGAUAGGGGU, ie, SEQ ID NO.1), and miRNA155 linear probe 1 (sequence: TTAATGCTAATTGGCATGAAACCAGTGCTGAGTGTCAGAGACCCCTATCAC, ie, SEQ ID NO.2, a, b, c of the linear probe is designed) See Table 1 for the three regions), PCR-F1 (sequence: TTAATGCTAATTGGCATGAAAC, ie SEQ ID NO.3) and PCR-R1 (sequence: TTAATGCTAATTGTGATAGGGGT, ie SEQ ID NO.4) for reverse...

Embodiment 2

[0060] Example 2 Using linear probes to detect different concentrations of miRNA

[0061] This embodiment uses miRNA155 as the target (ie SEQ ID NO.1), using miRNA155 linear probe 1 (ie SEQ ID NO.2), PCR-F1 (ie SEQ ID NO.3), PCR-R1 (ie SEQ ID NO. NO.4) Perform reverse transcription and PCR amplification reactions, and detect different concentrations of target miRNA155 through fluorescent signals. miRNA122 (ie, SEQ ID NO.5) was used as a negative control, and water instead of the target was used as a blank control. Specific steps are as follows:

[0062] 1. Reverse transcription: i) prepare 15uL of reverse transcription reaction base solution; 7 , 3×10 6 , 3×10 5 , 3×10 4 , 3×10 3 , 3×10 2 , 3×10 1 , 3 copies of the target miRNA155, and mix the reaction solution; iii) place it on a PCR instrument, react at 42°C for 15min, and inactivate the reverse transcriptase activity at 85°C for 5min.

[0063] 2. Quantitative PCR amplification: the same as in Example 1.

[0064] F...

Embodiment 3

[0065] Embodiment 3 verifies the effect of linear probe d area and b area

[0066] The linear probe of the present invention includes three regions a, b and c, and may also include region d. The nucleotide sequence of the a region is complementary to the target nucleic acid, the nucleotide sequence of the b region assists loop formation by reducing steric hindrance, and the nucleotide sequence of the c region is identical to the 5' end of the target nucleic acid. The nucleotide sequence of the region d is a nucleotide sequence extending the length of the probe. By adjusting the GC content of d region and b region, the annealing temperature of upstream and downstream PCR primers is similar.

[0067] In this example, miRNA155 was used as the target miRNA (ie, SEQ ID NO.1), and corresponding linear probes and PCR primers were designed for reverse transcription and PCR amplification reactions, and the functions of the d and b regions of the probe were verified by fluorescent sign...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a linear probe. The linear probe at least comprises a region a, a region b and a region c, wherein the 3' end of the region b is connected with the 5' end of the region a, and the 3' end of the region c is connected with the 5' end of the region b; and the nucleotide sequence of the region a is complementarily paired with the 3' end of the target nucleic acid, the nucleotide sequence of the region b assists in looping by reducing steric hindrance, and the nucleotide sequence of the region c is the same as the 5' end of the target nucleic acid. After the linear probe and the target miRNA are subjected to two times of specific recognition in a reverse transcription process, cDNA of a stem-loop structure is formed under the assistance of the region b, and meanwhile, the target miRNA is released to participate in the next round of cDNA formation. Ring formation and cyclic reverse transcription are assisted by the region b, so that the required reverse transcription time is shorter, and meanwhile, effective reverse transcription is realized on a low-concentration target; and PCR (Polymerase Chain Reaction) amplification is carried out by taking the cDNA as a template to realize rapid, sensitive and specific detection of the target nucleic acid.

Description

technical field [0001] The invention relates to the technical field of nucleic acid detection, in particular to a linear probe and a method for detecting miRNA using the same. Background technique [0002] Nucleic acid detection has been widely used in clinical detection, environmental monitoring, prevention and control of infectious diseases, etc. Among them, miRNA (miR) is a kind of single-stranded non-coding RNA composed of 20-25 nucleotides, which degrades the target messenger RNA or inhibits its translation by binding to the 3' untranslated region of the target messenger RNA. Transcriptional or post-transcriptional level regulates the expression of protein-coding genes, thereby regulating cell differentiation, growth, proliferation, metabolism, apoptosis, etc. Nucleic acid detection of miRNA is of great significance. [0003] Traditional miRNA detection methods such as northern blotting are currently the gold standard for miRNA detection. In this method, the probe is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/11C12Q1/686
CPCC12Q1/686C12Q2525/207C12Q2525/307C12Q2521/107C12Q2561/101C12Q2563/107
Inventor 刘孟坛
Owner 刘孟坛
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap