Recombinant amide hydrolase gene and application thereof

An amidohydrolase and gene technology, which is applied to recombinant amidohydrolase genes and their application fields, can solve problems such as lack of an amidohydrolase preparation method, and achieve the effects of simple and efficient preparation method, improved expression efficiency and good stability

Pending Publication Date: 2021-10-08
GUANGDONG HEJI BIOTECH CO LTD
View PDF11 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, lack the preparation method of the amidohydrolase that can be applied to industrialized production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant amide hydrolase gene and application thereof
  • Recombinant amide hydrolase gene and application thereof
  • Recombinant amide hydrolase gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] This embodiment provides a recombinant amidohydrolase gene, which includes the nucleotide sequence shown in SEQ ID No.1.

[0056] SEQ ID No. 1:

[0057] atgctgtctctggttctgccgggtatcggtcacgctcagaccacccagccgccgccggctccggctaaaccggttctgttcaccaacttccgtctgttcgacggtaaatcttctgctctgcgtgacggtctgtacatggttgttgaaggtaacaccatctctcagatcggtcagggtcagccggcttcttctgaaggtaaaaccgttgttgactgcggtggtaaagttatcatgccgggtctgatcgacatgcactggcactctctgctggctgctctgccgatccaggttatcctgcaggctgacatcgctttcgttcacctggctgcttctgctgaagctgaacgtaccctgatgcgtggtttcaccaccatccgtgacgctggtggtccgtctttcgctctgaaacaggctatcgactctggtatgatctctggtccgcgtatctacccgtctggtgctatgatcaccaccaccggtggtcacggtgacttccgttctctggctgaactgccgcgtacctctaaccaggtttctcaggctgaacgtgacggtgctaacgctatcgctgacaccgctgacgaagttcgtatgcgtgttcgtgaacagttcatccagggtgctacccagatcaaaatggttggttgcggtggtgtttctaccccgcgttctccgctggacatgctgaccttcaccgaagaccagatgcgtgctgctgttgaaaccgctgctgactggggtacctacatcctggttcacgcttacaccccggaatctatccagcgttctgttgctgctggtgttcagtgcgttgaacacggtcacctgatgga...

Embodiment 2

[0060] This embodiment provides a recombinant vector, which is a recombinant pET-21a vector containing the recombinant amidohydrolase gene in Example 1.

[0061] After GenScript synthesized the recombinant amidohydrolase gene fragment, it was connected to the pET-21a vector to obtain the recombinant pET-21a vector.

[0062] The plasmid map of the recombinant vector is as follows figure 1 shown.

Embodiment 3

[0064] This embodiment provides a recombinant cell, which is a competent cell containing the recombinant vector in Embodiment 2.

[0065] The recombinant cells are prepared by the following method:

[0066] (1) Thaw ArcticExpress DE3, OverExpress C43 DE3, ER2566HE and BL21 DE3 competent cells on ice, add recombinant vector, mix gently, and ice bath for 25 minutes;

[0067] (2) After heat shock at 42°C for 45s, ice bath for 2min;

[0068] (3) Add 700 μL of LB medium without antibiotics to the tube, and incubate with shaking at 37°C and 200 rpm for 60 min;

[0069] (4) The cultured bacterial solution is spread on the surface of LB solid medium containing 0.1g / mL ampicillin, and placed upside down in an incubator for 14 hours;

[0070] (5) A single colony grown on the plate is a positive clone, and the recombinant cells are obtained after identification and screening.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Concentrationaaaaaaaaaa
Concentrationaaaaaaaaaa
Login to View More

Abstract

The invention provides a recombinant amide hydrolase gene and application thereof. The recombinant amide hydrolase gene comprises a nucleotide sequence as shown in SEQ ID No. 1. The invention also provides a recombinant vector, a recombinant cell, a preparation method of recombinant amide hydrolase and the recombinant amide hydrolase prepared by the preparation method. The recombinant amide hydrolase gene provided by the invention has high expression efficiency in recipient cells, and provides conditions for industrialized production of amide hydrolase; the preparation and purification method of the amide hydrolase is simple and efficient; and the obtained amide hydrolase has good catalytic activity and stability and has practical application value in production.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a recombinant amidohydrolase gene and its application. Background technique [0002] Amidohydrolase, also known as acyltransferase and acylamino acid hydrolase, is an enzyme that hydrolyzes N-acyl-L organic acids and amino acids, and can also catalyze the hydrolysis of dehydropeptides. It exists in animal tissues, fungi and bacteria, plays an important role in the body, and is closely related to various metabolic activities of the human body. [0003] Japanese researchers Takakura Y and Y.Asano found that Burkholderia sp LP5 18B can be metabolized to produce amidohydrolase (EC3.5.1.14), and applied it to the synthesis and hydrolysis of amino acid surfactants. Lauroyl phenylalanine, lauroyl alanine, lauroyl lysine, lauroyl valine, etc. have good hydrolysis catalytic effects, and have good catalytic effects on lauroyl arginine and lauroyl valine To synthesize the catalytic effect, th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N15/70C12N9/80C12N1/21C12P7/64C12P13/04C12R1/19
CPCC12N9/80C12N15/70C12P7/6409C12P13/04C12P13/005C12Y305/01014
Inventor胡丽云曾惠羚任杰何廷刚艾勇张炽坚
OwnerGUANGDONG HEJI BIOTECH CO LTD