Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Preparation method of capillary sensor based on capillarity and application thereof

A capillary phenomenon, capillary technology, applied in the field of biosensors

Active Publication Date: 2021-10-08
HUNAN UNIV OF SCI & TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there is no literature or patent report on the use of mesoporous silica as a carrier for surfactants.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] (1) Aminated mesoporous silica (MSN-NH 2 ) to load FS-31

[0030] MSN-NH 2 Ultrasonic dispersion in 0.1% FS-31, after shaking for 24 h, the MSN-NH loaded with FS-31 was obtained 2 ;

[0031] (2) Capping of nucleic acid aptamers

[0032] In order to realize the detection of mercury ions, we choose the nucleic acid adapter DNA strand corresponding to mercury ions: TTTTTTTTTTTTTTTTTTTT, with a length of 20 T bases; take 10.0 μg / mL MSN-NH loaded with FS-31 in (1) 2 , add 2.5 μmol / L DNA aqueous solution. At this time, the total volume is 500 μL. After ultrasonication for 5 minutes, place in a constant temperature water bath at 37°C for 3 hours, then add 200 μL of ethanol, shake fully, centrifuge, wash with ethanol, and finally put it in a vacuum at 37°C. Dry in oven for 20 min;

[0033] (3) Modification of capillary

[0034] Absorb the clean capillary with 1% PDDA aqueous solution obliquely, seal it with plastic wrap, place it for adsorption at room temperature for 30 ...

Embodiment 2

[0038] (1) Aminated mesoporous silica (MSN-NH 2 ) to load the FS-300

[0039] MSN-NH 2 Ultrasonic dispersion in 0.3% FS-300, after shaking for 30 h, the MSN-NH loaded with FS-300 2 ;

[0040] (2) Capping of nucleic acid aptamers

[0041] In order to realize the detection of ATP, we choose the aptamer DNA chain corresponding to ATP: ACCTGGGGGAGTATTGCGGAGGAAGGT, with a length of 27 bases; take 5.0 μg / mLMSN-NH loaded with FS-300 in (1) 2 , add 4.0 μmol / L DNA aqueous solution. At this time, the total volume is 500 μL. After ultrasonication for 5 minutes, place in a constant temperature water bath at 37°C for 3 hours, then add 500 μL of ethanol, shake fully, centrifuge, wash with ethanol, and finally put it in 40°C for vacuum drying Oven drying for 10min;

[0042] (3) Modification of capillary

[0043] Absorb the clean capillary obliquely with 0.1% PDADMAC aqueous solution, place it for adsorption at room temperature for 30 min, and blow dry with high-purity nitrogen gas to o...

Embodiment 3

[0047] (1) Aminated mesoporous silica (MSN-NH 2 ) to load FS-31

[0048] MSN-NH 2 Ultrasonic dispersion in 0.3% FS-31, after shaking for 24 h, the MSN-NH loaded with FS-31 was obtained 2 ;

[0049] (2) Capping of nucleic acid aptamers

[0050] In order to realize the detection of prostate-specific antigen (PSA), we selected the aptamer DNA chain corresponding to PSA: TTTTTAATTAAAGCTCGCCATCAAATAGCTTT, with a length of 32 bases; 10.0 μg / mL of FS-31 loaded in (1) MSN-NH 2 , add 2.5 μmol / L DNA aqueous solution. At this time, the total volume is 500 μL. After ultrasonication for 10 min, place in a constant temperature water bath at 45°C for 1.5 h, then add 500 μL of 40% methanol solution to wash by centrifugation, and dry in a vacuum oven at 45°C for 10 min. , to obtain the MSN-NH of DNA capping FS-31 2 ;

[0051] (3) Modification of capillary

[0052] Absorb the clean capillary obliquely with 0.3% PDADMAC aqueous solution, place it for adsorption at room temperature for 30...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a preparation methodof a capillary biosensor based on capillarity, which comprises the following steps: loading a surfactant on an aminated mesoporous silica ball with positive electricity on the surface, sealing the mesoporous of the silica ball by using a nucleic acid aptamer with a certain base length, and modifying the sealed silica ball on the inner wall of a capillary in an adsorptive manner, and preparing the capillary sensor with target identification. When a target to-be-detected object exists, the nucleic acid aptamer on the meso-porous silicon ball can be specifically combined with the target to be detected and is separated from the surface of the meso-porous particle, so that a surfactant loaded in the meso-pores is released. As the surfactant is dispersed in the aqueous solution to reduce the surface tension of water, the liquid level of a water column rising through the capillarity in the capillary tube is reduced, and the concentration of a target object can be quantified by utilizing the change of the height of the water column in the capillary tube. The sensor does not need complex instruments, is simple and rapid to operate, low in cost and wide in applicable target object range, can be used for detecting toxins, small molecules, ions, proteins and the like, and has commercial application value.

Description

technical field [0001] The invention relates to the technical field of biosensors, in particular to the preparation and application of a capillary-based biosensor. Background technique [0002] Visual sensors can detect analyte signals without the use of complex external instruments, and quantitatively detect target molecules through color and volume changes. Simple, fast, and instrument-free are the trends in future testing, and the results of visual testing can be distinguished with the naked eye through readings. Visualization sensors are attractive detection tools that allow rapid and on-demand monitoring of specific samples, avoiding costly and complex instrumentation. [0003] Capillarity is a common natural phenomenon. The motion of the water column in the capillary can be described by Jurin's law. The surface tension of a liquid is a property of the liquid itself and is mainly determined by the liquid itself. Surfactants can reduce the surface tension of water by...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/00
CPCG01N33/00Y02A50/30Y02P20/54
Inventor 邓克勤刘彰肖靖李春香周虎
Owner HUNAN UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com