Preparation method of capillary sensor based on capillarity and application thereof
A capillary phenomenon, capillary technology, applied in the field of biosensors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0029] (1) Aminated mesoporous silica (MSN-NH 2 ) to load FS-31
[0030] MSN-NH 2 Ultrasonic dispersion in 0.1% FS-31, after shaking for 24 h, the MSN-NH loaded with FS-31 was obtained 2 ;
[0031] (2) Capping of nucleic acid aptamers
[0032] In order to realize the detection of mercury ions, we choose the nucleic acid adapter DNA strand corresponding to mercury ions: TTTTTTTTTTTTTTTTTTTT, with a length of 20 T bases; take 10.0 μg / mL MSN-NH loaded with FS-31 in (1) 2 , add 2.5 μmol / L DNA aqueous solution. At this time, the total volume is 500 μL. After ultrasonication for 5 minutes, place in a constant temperature water bath at 37°C for 3 hours, then add 200 μL of ethanol, shake fully, centrifuge, wash with ethanol, and finally put it in a vacuum at 37°C. Dry in oven for 20 min;
[0033] (3) Modification of capillary
[0034] Absorb the clean capillary with 1% PDDA aqueous solution obliquely, seal it with plastic wrap, place it for adsorption at room temperature for 30 ...
Embodiment 2
[0038] (1) Aminated mesoporous silica (MSN-NH 2 ) to load the FS-300
[0039] MSN-NH 2 Ultrasonic dispersion in 0.3% FS-300, after shaking for 30 h, the MSN-NH loaded with FS-300 2 ;
[0040] (2) Capping of nucleic acid aptamers
[0041] In order to realize the detection of ATP, we choose the aptamer DNA chain corresponding to ATP: ACCTGGGGGAGTATTGCGGAGGAAGGT, with a length of 27 bases; take 5.0 μg / mLMSN-NH loaded with FS-300 in (1) 2 , add 4.0 μmol / L DNA aqueous solution. At this time, the total volume is 500 μL. After ultrasonication for 5 minutes, place in a constant temperature water bath at 37°C for 3 hours, then add 500 μL of ethanol, shake fully, centrifuge, wash with ethanol, and finally put it in 40°C for vacuum drying Oven drying for 10min;
[0042] (3) Modification of capillary
[0043] Absorb the clean capillary obliquely with 0.1% PDADMAC aqueous solution, place it for adsorption at room temperature for 30 min, and blow dry with high-purity nitrogen gas to o...
Embodiment 3
[0047] (1) Aminated mesoporous silica (MSN-NH 2 ) to load FS-31
[0048] MSN-NH 2 Ultrasonic dispersion in 0.3% FS-31, after shaking for 24 h, the MSN-NH loaded with FS-31 was obtained 2 ;
[0049] (2) Capping of nucleic acid aptamers
[0050] In order to realize the detection of prostate-specific antigen (PSA), we selected the aptamer DNA chain corresponding to PSA: TTTTTAATTAAAGCTCGCCATCAAATAGCTTT, with a length of 32 bases; 10.0 μg / mL of FS-31 loaded in (1) MSN-NH 2 , add 2.5 μmol / L DNA aqueous solution. At this time, the total volume is 500 μL. After ultrasonication for 10 min, place in a constant temperature water bath at 45°C for 1.5 h, then add 500 μL of 40% methanol solution to wash by centrifugation, and dry in a vacuum oven at 45°C for 10 min. , to obtain the MSN-NH of DNA capping FS-31 2 ;
[0051] (3) Modification of capillary
[0052] Absorb the clean capillary obliquely with 0.3% PDADMAC aqueous solution, place it for adsorption at room temperature for 30...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
PatSnap Eureka turns technology decisions into work you can execute. Powered by our Innovation Knowledge Graph, it runs expert workflows across engineering, life sciences, materials and intellectual property. Get your review-ready output in minutes.
