Primer and method for fluorescent quantitative PCR detection of Enterocytozoon hepatopenaei (EHP)
A fluorescence quantitative, Enterospora hepatis technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of time-consuming, cumbersome operation, etc. The effect of shortening the detection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment example 1
[0035] The pMD19T cloning vector involved in this implementation case, DH5α cloning competence and easydilution for constructing standards for diluted plasmids were purchased from Takara Biotechnology Co., Ltd.
[0036] The EHPSWP sequence information involved in this implementation case has been published in NCBI.
[0037] This implementation case constructs the EHP-SWP standard plasmid, the main steps are as follows:
[0038] 1) Extract the total DNA of the hepatopancreas of Penaeus vannamei naturally infected with EHP;
[0039] 2) Design primers according to the EHP-SWP sequence published by Ncbi, and obtain the EHP-SWPORF sequence by PCR amplification;
[0040] 3) connect the pMD 19T plasmid, and transform DH5α;
[0041] 4) Positive clones were obtained through sequencing identification, and after expansion and cultivation, plasmids were extracted;
[0042] 5) The Nanodrop nucleic acid analyzer measures the plasmid concentration, and converts the EHP infection copy numb...
Embodiment example 2
[0045] Screening of implementation case 2 specific primers
[0046] On the basis of the preliminary screening, the following 2 pairs of primers were finally determined for multiple comparison experiments:
[0047] Primer pair 1EHP146F: TGGCGGCACAATTCTCAA
[0048] EHP146R: GCTGTTTGTCTCCAACTGTA
[0049] Primer pair 2F: TGGCGGCACAATTCTCAAACAT
[0050] R: GCTGTGTCTGTGTAAATATCGTCTC
[0051] In this implementation case, TB Green Premix Ex Taq II (TliRNaseH Plus) (2*) was purchased from Takara Biotechnology Co., Ltd.
[0052] In this implementation case, by constructing a standard curve, the amount of EHP infection in Penaeus vannamei juveniles (<2cm) and "growth retarded" adult Penaeus vannamei was detected. The specific steps are as follows:
[0053] 1. Sample collection and DNA extraction: take whole individuals from larvae, larvae and juveniles smaller than 2cm, and hepatopancreas from juveniles larger than 2cm, subadult shrimp and adults. Samples were collected in the range...
Embodiment example 3
[0063] In this implementation case, TB Green Premix Ex Taq II (TliRNaseH Plus) (2*) was purchased from Takara Biotechnology Co., Ltd.
[0064] In this implementation case, by constructing a standard curve, the amount of EHP infection in Penaeus vannamei juveniles (<2cm) and "growth retarded" adult Penaeus vannamei was detected. The specific steps are as follows:
[0065] 1. Sample collection and DNA extraction: take whole individuals from larvae, larvae and juveniles smaller than 2cm, and hepatopancreas from juveniles larger than 2cm, subadult shrimp and adults. Samples were collected in the range of 10-50 mg, and the total DNA of the samples was extracted using the Qiagen DNA Mini Kit kit in strict accordance with the kit instructions.
[0066] 2. Fluorescent quantitative PCR detection:
[0067] 1) The reaction system is as follows, with a total volume of 25ul: TB Green Premix Ex Taq II (TliRNaseH Plus) (2X): 12.5ul, 1.25ul each of the primers of the sequences described in E...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com