Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene recombination method mediated by VWB-attP and [phi]C31-attP integrase and application thereof

A technology of genetic recombination and streptomyces, applied in the biological field, can solve problems such as limited application range

Pending Publication Date: 2021-11-02
SHANGHAI INST OF ORGANIC CHEM CHINESE ACAD OF SCI +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although there is an integrase-mediated gene recombination method in the prior art, its application range is still very limited, and the field still needs to further develop and optimize the gene recombination method of Streptomyces in order to further improve its biosynthetic ability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene recombination method mediated by VWB-attP and [phi]C31-attP integrase and application thereof
  • Gene recombination method mediated by VWB-attP and [phi]C31-attP integrase and application thereof
  • Gene recombination method mediated by VWB-attP and [phi]C31-attP integrase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0147] Example 1 Construction of a plasmid containing VWB-attP integrase and φC31-attP integrase modules and introduction into Streptomyces avermitilis

[0148]Streptomyces routinely used plasmid pSOK804 (GenBank: LT545994.1) contains a complete VWB-attP integrase module, and Streptomyces routinely used plasmid pSET152 (GenBank: AJ414670.1) contains a complete φC31-attP integrase module. Digest the pSOK804 plasmid with XbaI to obtain the complete VWB-attP integrase module, and then connect it to the XbaI restriction site of pSET152 to obtain a plasmid containing both VWB-attP integrase and φC31-attP integrase modules , about 7.8kb in size, and the plasmid number is named pBa1. In order to test whether the constructed plasmid can be completely applied in Streptomyces, it was introduced into Streptomyces avermitilis ATCC31267 by conjugative transfer method. According to the analysis of the genome sequence of Streptomyces avermitilis, it was found that there are 3 natural endoge...

Embodiment 2

[0183] Example 2 Increase the VWB-integase attP module in the cosmid 71320 containing the avermectin synthesis gene cluster aveA1-aveA2-aveC and introduce it into the S. avermitilis△olm: attB strain

[0184] Cosmid 71320 contains the 34kb avemectin biosynthetic gene cluster aveD-aveA1-aveA2-aveC, which is obtained by using the pOJ436 plasmid as a carrier and screening after establishing the abamectin genome library. The cosmid backbone of 71320 has Has a φC31-attP integrase module. The VWB-attP integrase module was obtained by PCR, and the 71320 cosmid was recombined with RedET to obtain the 71320 cosmid with both VWB-attP and φC31-attP integrase modules. The modified cosmid number was pBa1-71320-804 .

[0185] S. avermitilis△olm: attB strain knocks out the olmA1-A7 gene of the oligomycin biosynthesis gene cluster PKS through homologous recombination double crossover, and introduces a synthetic φC31-8×attB insertion box sequence at the knockout position (For sequence informa...

Embodiment 3

[0192] Example 3 Plasmid pBa1 is introduced into the erythromycin strain S.erythraea E3-attB

[0193]The erythromycin S. erythraeaE3-attB strain is the modified strain involved in Example 1 of the inventor's authorized patent ZL200910194419.4, which has an exogenously introduced Ery-φC31-8×attB site. At the same time, according to the analysis of the erythromycin genome sequence, there is also a complete sequence of a natural endogenous Ery-VWB-attB site, 76bp in size, and the sequence is as follows:

[0194] GCCCTCGTAGCTCAGGGGATAGAGCACCGCTCTCCTAAAGCGGGTGTCGCAGGTTCGAATCCTGCCGGGGGCGCAA (SEQ ID NO: 12)

[0195] The plasmid pBa1 was introduced into the S. erythraea E3-attB strain by conjugative transfer, and the primers on both sides of the integrated attL sequence were used for PCR verification to detect whether site-specific recombination and integration occurred.

[0196] Primer 6S on one side of Ery-VWB-attB site: ATCCTCGCCGTCGTTCGGACCTTC (SEQ ID NO: 23)

[0197] Ery-φC31-8...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene recombination method mediated by VWB-attP and [phi]C31-attP integrase and an application thereof. Specifically, the two integrase modules are constructed in the same plasmid containing a target gene by utilizing a site-specific integration mechanism mediated by a VWB-attP integrase system and a [phi]C31-attP integrase system; and a target gene needing to be expressed can be rapidly recombined to a corresponding attB site of a streptomyces chromosome in a multi-copy number through inter-genus conjugation transfer. The method disclosed by the invention is applied to abamectin, erythromycin and lincomycin producing bacteria.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically relates to the use of a site-specific integration and recombination mechanism mediated by VWB-attP integrase and φC31-attP integrase system to obtain multiple copies of the target gene introduced into Streptomyces chromatin Background technique [0002] Streptomyces is a type of bacteria that can metabolize and produce natural products in nature. In the field of pharmaceutical industry applications, most antibiotic raw materials are produced through Streptomyces fermentation. For example, erythromycin is produced by fermentation of Saccharopolysporaerythraea, abamectin is produced by fermentation of Streptomyces avermitilis, and lincomycin is produced by fermentation of Streptomyces lincolnensis. With the development of biotechnology, through genetic modification of Streptomyces, the problems of yield and components in the production process of industrial strains can be solved. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/76C12N15/74C12N1/21C12N15/52C12R1/565C12R1/465C12R1/01
CPCC12N15/76C12N15/74C12N15/52
Inventor 刘文张庆林冯俊寅潘佳明陈单丹王杰
Owner SHANGHAI INST OF ORGANIC CHEM CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com