Gene recombination method mediated by VWB-attP and [phi]C31-attP integrase and application thereof
A technology of genetic recombination and streptomyces, applied in the biological field, can solve problems such as limited application range
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0147] Example 1 Construction of a plasmid containing VWB-attP integrase and φC31-attP integrase modules and introduction into Streptomyces avermitilis
[0148]Streptomyces routinely used plasmid pSOK804 (GenBank: LT545994.1) contains a complete VWB-attP integrase module, and Streptomyces routinely used plasmid pSET152 (GenBank: AJ414670.1) contains a complete φC31-attP integrase module. Digest the pSOK804 plasmid with XbaI to obtain the complete VWB-attP integrase module, and then connect it to the XbaI restriction site of pSET152 to obtain a plasmid containing both VWB-attP integrase and φC31-attP integrase modules , about 7.8kb in size, and the plasmid number is named pBa1. In order to test whether the constructed plasmid can be completely applied in Streptomyces, it was introduced into Streptomyces avermitilis ATCC31267 by conjugative transfer method. According to the analysis of the genome sequence of Streptomyces avermitilis, it was found that there are 3 natural endoge...
Embodiment 2
[0183] Example 2 Increase the VWB-integase attP module in the cosmid 71320 containing the avermectin synthesis gene cluster aveA1-aveA2-aveC and introduce it into the S. avermitilis△olm: attB strain
[0184] Cosmid 71320 contains the 34kb avemectin biosynthetic gene cluster aveD-aveA1-aveA2-aveC, which is obtained by using the pOJ436 plasmid as a carrier and screening after establishing the abamectin genome library. The cosmid backbone of 71320 has Has a φC31-attP integrase module. The VWB-attP integrase module was obtained by PCR, and the 71320 cosmid was recombined with RedET to obtain the 71320 cosmid with both VWB-attP and φC31-attP integrase modules. The modified cosmid number was pBa1-71320-804 .
[0185] S. avermitilis△olm: attB strain knocks out the olmA1-A7 gene of the oligomycin biosynthesis gene cluster PKS through homologous recombination double crossover, and introduces a synthetic φC31-8×attB insertion box sequence at the knockout position (For sequence informa...
Embodiment 3
[0192] Example 3 Plasmid pBa1 is introduced into the erythromycin strain S.erythraea E3-attB
[0193]The erythromycin S. erythraeaE3-attB strain is the modified strain involved in Example 1 of the inventor's authorized patent ZL200910194419.4, which has an exogenously introduced Ery-φC31-8×attB site. At the same time, according to the analysis of the erythromycin genome sequence, there is also a complete sequence of a natural endogenous Ery-VWB-attB site, 76bp in size, and the sequence is as follows:
[0194] GCCCTCGTAGCTCAGGGGATAGAGCACCGCTCTCCTAAAGCGGGTGTCGCAGGTTCGAATCCTGCCGGGGGCGCAA (SEQ ID NO: 12)
[0195] The plasmid pBa1 was introduced into the S. erythraea E3-attB strain by conjugative transfer, and the primers on both sides of the integrated attL sequence were used for PCR verification to detect whether site-specific recombination and integration occurred.
[0196] Primer 6S on one side of Ery-VWB-attB site: ATCCTCGCCGTCGTTCGGACCTTC (SEQ ID NO: 23)
[0197] Ery-φC31-8...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com

![Gene recombination method mediated by VWB-attP and [phi]C31-attP integrase and application thereof](https://images-eureka.patsnap.com/patent_img/2d45872d-a4fa-4d1b-9a3c-2ac2837f1abf/BDA0002474880410000171.png)
![Gene recombination method mediated by VWB-attP and [phi]C31-attP integrase and application thereof](https://images-eureka.patsnap.com/patent_img/2d45872d-a4fa-4d1b-9a3c-2ac2837f1abf/BDA0002474880410000181.png)
![Gene recombination method mediated by VWB-attP and [phi]C31-attP integrase and application thereof](https://images-eureka.patsnap.com/patent_img/2d45872d-a4fa-4d1b-9a3c-2ac2837f1abf/BDA0002474880410000191.png)