Method and kit for detecting human HER2 gene copy number variation

A technology of gene copy number and copy number variation, which is applied in the fields of genomics, biochemical equipment and methods, and microbial measurement/inspection, to achieve the effects of simple process, improved sensitivity, and low sample size requirements

Active Publication Date: 2021-11-09
CARRIER GENE TECH SUZHOU CO LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, it is of great clinical significance to be able to detect copy number variations of the HER2 gene from liquid biopsy samples, while the sensitivity of traditional next generation sequencing (NGS, next generation sequencing) methods for detecting copy number variations in cfDNA samples is only 30% (ie more out or less than 30% of the copy number)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for detecting human HER2 gene copy number variation
  • Method and kit for detecting human HER2 gene copy number variation
  • Method and kit for detecting human HER2 gene copy number variation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Detection of HER2 copy number variation in tumor FFPE DNA samples from patients with gastric cancer

[0042] (1) Sample DNA extraction

[0043]FFPE DNA was extracted using Qiagen GeneRead DNA FFPE kit, and the specific operation was performed according to the instructions of the kit. Extract 4 normal HER2-negative samples and 4 FFPE samples from gastric cancer HER2-positive patients. Quantification with Qubit fluorescence.

[0044] (2) qPCR accurately quantifies FFPE and cfDNA by using two pairs of housekeeping gene primers ref1 and ref2 (ref1-fP gcacaacattttgtctccggaaaata, ref1-rP gctccagatgggcagcac; ref2-fPgacaaatgcccagaaatggaactta, ref2-rP ttggcagtctttaagatccatagaaatac) to test samples and two An internal reference uninterrupted gDNA sample (2 μl 1ng / μl and 2 μl 10ng / μl) was amplified to obtain the ct value, and the concentration of the primers was 4 μM. The quantitative formula is:

[0045]

[0046]

[0047] N-avg=Average(N1+N2)

[0048] Nu=10 ...

Embodiment 2

[0072] Example 2: Detection of HER2 copy number variation in tumor peripheral blood cfDNA samples of patients with gastric cancer

[0073] (1) DNA extraction

[0074] cfDNA extraction using Nanke Zhengtu Apostle MiniMax TM Free DNA isolation and enrichment kit, specifically according to the instructions of the kit. Extract 4 normal HER2-negative samples, and extract 4 gastric cancer HER2-positive patients. Quantification with Qubit fluorescence.

[0075] (2) qPCR accurately quantifies FFPE and cfDNA by using two pairs of housekeeping gene primers ref1 and ref2 (ref1-fP gcacaacattttgtctccggaaaata, ref1-rP gctccagatgggcagcac; ref2-fPgacaaatgcccagaaatggaactta, ref2-rP ttggcagtctttaagatccatagaaatac) to test samples and 2 An internal reference uninterrupted gDNA sample (2 μl 1ng / μl and 2 μl 10ng / μl) was amplified to obtain the ct value, and the concentration of the primers was 4 μM. The quantitative formula is:

[0076]

[0077]

[0078] N-avg=Average(N1+N2)

[0079] Nu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and a kit for detecting human HER2 gene copy number variation. The method comprises the following steps: designing a multiple primer group, extracting and quantifying a DNA sample, then carrying out UMI PCR, carrying out magnetic bead purification, then carrying out semi-nested PCR, carrying out further purification, then carrying out index PCR and target fragment magnetic bead sorting, and finally carrying out NGS data analysis to calculate the sample HER2 gene copy number variation condition. Compared with the conventional HER2 detection method, the method provided by the invention can detect 5% of copy number change, greatly improves the detection sensitivity, is low in sample demand and simple in process, and does not depend on subjective judgment; and in addition, a sample of liquid biopsy origin may be detected.

Description

technical field [0001] The invention relates to a method and a kit for detecting variation in the copy number of human HER2 gene, which belong to the technical field of gene sequencing. Background technique [0002] The HER2 gene belongs to the epidermal growth factor receptor tyrosine kinase family and is the driving gene for a variety of cancers, such as lung cancer, gastric cancer, breast cancer, and colorectal cancer. The HER2 gene is located on chromosome 17. Through amplification, the HER2 protein can be overexpressed, thereby driving the occurrence of tumors. [0003] The proportion of HER2 protein overexpression in clinical gastric cancer and gastroesophageal junction cancer patients is as high as 3.7%-20.2% ("Guidelines for HER2 Detection of Gastric Cancer (2016 Edition)"), among which patients with gastroesophageal junction cancer can reach 30% . Based on the evidence from the phase III clinical trial ToGA, patients with advanced HER2-positive disease can obtain ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6869C12Q1/6886G16B20/20G16B25/20
CPCC12Q1/6869C12Q1/6886G16B20/20G16B25/20C12Q2600/156C12Q2531/113C12Q2549/119C12Q2545/101C12Q2523/308Y02A50/30
Inventor杨玉霞罗俊峰汪相江吴若嘉
OwnerCARRIER GENE TECH SUZHOU CO LTD