Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific detection target of BCC (Burkholderia cepacia complex) and constant-temperature rapid detection method

A Burkholderia and detection method technology, applied in chemical instruments and methods, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems of few gene mutation sites and lack of rapid screening of BCC , to achieve the effect of strong specificity, high accuracy and high sensitivity

Pending Publication Date: 2021-11-26
SHANGHAI INST FOR FOOD & DRUG CONTROL
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is a lack of specific gene targets with few gene mutation sites and relatively conservative for rapid screening of BCC

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific detection target of BCC (Burkholderia cepacia complex) and constant-temperature rapid detection method
  • Specific detection target of BCC (Burkholderia cepacia complex) and constant-temperature rapid detection method
  • Specific detection target of BCC (Burkholderia cepacia complex) and constant-temperature rapid detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] In this example, by writing a Python script command, based on the comparison of microbial proteomes under big data, the specific protein and its gene coding sequence of the Burkholderia cepacia complex were excavated. The specific experimental steps and results are as follows:

[0038] refer to figure 1 , the proteome sequence information of 341 strains of Burkholderia sp. was downloaded from the public database of the National Center for Biotechnology Information (NCBI). Among them, 78 microorganisms belonged to the target BCC, and 263 belonged to other Burkholderia microorganisms that were not the target BCC. Nine common species in BCC, ie, genomovar I-IX genotypes, were selected as targets (see Table 1), and their specific protein sequences were screened and compared.

[0039] By writing Python script commands and using DIAMOND software (version 0.9.26), the protein sequences of 341 strains of microorganisms were compared for the first time (the E value parameter wa...

Embodiment 2

[0046] This example provides the amplification primers and probes for the secY gene and the isothermal detection method for the recombinase polymerase of the Burkholderia cepacia complex.

[0047] 1. Download the gene sequence corresponding to the screened specific protein sequence from the GeneBank database, and compare the above sequences with MEGA X software to find relatively conserved regions, and mark the degenerate bases according to the sequence comparison information. Primer Premier 5.0 software was used to design upstream and downstream primers and probes according to the RPA design principles of TwistDx company (Table 2). Primers and probes were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

[0048] Table 3. Nucleic acid sequences of primers and probes used in the test

[0049]

[0050]

[0051] The secY gene sequence was obtained from the GeneBank database. In the relatively conserved region, degenerate bases were marked according to the sequence...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a specific detection target of a BCC (Burkholderia cepacia complex) and a constant-temperature rapid detection method. The specific detection target is a sec Y gene, an RPA primer composition is designed according to the gene, the RPA primer composition comprises an upstream primer with a sequence selected from one of SEQ ID No.1 to SEQ ID No.6, a downstream primer with a sequence selected from one of SEQ ID No.7 to SEQ ID No.9, and a probe with a sequence as follows: CAGGGCAACGGAAGATCACGCAGTACACGCGG[FAM-dT]A[THF][BHQ1-dT]TCACCGTGGTGCTCG[C3Spacer]. On the basis, the invention develops a high-throughput and rapid screening and detection method for the specific BCC; and the method is high in accuracy, strong in specificity and high in sensitivity, and is suitable for daily screening work of medical institutions, medicine and medical equipment production enterprises, cosmetic production enterprises and related detection institutions.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to a specific detection target and a constant temperature detection method of a Burkholderia cepacia complex. Background technique [0002] Onion Burkholderia cepacia Complex (BCC) is a general term for a class of Gram-negative, non-fermentative aerobic phenotypes similar to Proteobacteria β-subclass bacteria, which can be used in harsh and low-nutrition environments. Survive in the environment. In recent years, it has been found that BCC can cause bacteremia, urinary tract infection, septic arthritis, peritonitis, induce cystic fibrosis (cystic fibrosis, CF) and chronic granulomatous disease and other important conditional pathogens of respiratory diseases, which can lead to High mortality in infected and immunocompromised populations. Because BCC has a variety of virulence factors, natural antibacterial agents and multi-drug resistance to antibiotics, it is also one...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/04C12N15/11C12N15/31
CPCC12Q1/689C12Q1/6844C07K14/195C12Q2531/119C12Q2521/507C12Q2537/1376C12Q2563/107C12Q2522/101
Inventor 范一灵王淑娟宋明辉杨燕秦峰杨美成
Owner SHANGHAI INST FOR FOOD & DRUG CONTROL
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More