Unlock instant, AI-driven research and patent intelligence for your innovation.

Fusion protein and application thereof

A technology of fusion protein and protein, which is applied in the field of fusion protein and its application, can solve the problems of scarcity of R-loop means, lack of chain-specific information, and long time required for the process, so as to improve specificity, specificity recognition and Capturing and Simplifying the Effects of the Experimental Process

Active Publication Date: 2021-11-30
GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Moreover, there are relatively few methods on how to detect the active R-loop at the single-cell level
[0004] In general, the existing R-loop detection methods have some defects, mainly including: 1. The amount of cells used is large; 2. It is not in situ detection; 3. Lack of chain-specific information; 4. The process takes a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein and application thereof
  • Fusion protein and application thereof
  • Fusion protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] First, HBD-MNase fusion protein design, expression and purification

[0071] 1. Construct an HBD-MNase fusion protein expression vector

[0072] (1) Amplified the first functional area (SEQ ID NO.1) and the second functional area (SEQ ID NO. 2) PCR by primers. The primers are as follows:

[0073] The first functional area forward primers:

[0074] Atgggtcggigatccgaattcatgttctatgcggggggaggag seq ID no.7

[0075] The first functional area reverse primer:

[0076] Gaactcccccgtcatcaaaaggcccaggcctcatctt seq ID no.8

[0077] The second functional area forward primers:

[0078] Gatgacgataaggagttcgcaacttcaactaaaaaattaca seq ID no.9

[0079] Second functional area reverse primers:

[0080] GGTGGTGTGGTGTGTGTGTGTGTGTGTGTGTCGTTTTGTGACCTGAATCAGCGTTGTC SEQ ID NO.10

[0081] (2) The two DNA fragments are amplified into a fragment using a bridge PCR, i.e., the first functional region, and the forward primer of the second function zone are amplified in the forward primers and reverse primer...

Embodiment 2

[0109] Example 2 Design, Expression and Purification of HBD-TN5 fusion proteins

[0110] 1. Construct an HBD-TN5 fusion protein expression vector

[0111] (1) Amplification of the first functional area (SEQ ID NO.1) and the second functional area (SEQ ID NO. 3) PCR, respectively. The primers are as follows:

[0112] The first functional area forward primers:

[0113] Atgggtcggigatccgaattcatgttctatgcggggggaggag seq ID no.7

[0114] The first functional area reverse primer:

[0115] GGCTTTAGCCGCTGCCCCCTTTGCGCAGCAAAAGGCCCAGGCCCATCTT SEQ ID NO.11

[0116] The second functional area forward primers:

[0117] Gctgccgcaaaggaggcagcggggctaaagccatgattaccagtgcactgca seq ID NO.12

[0118] Second functional area reverse primers:

[0119] GGTGGTGTGGTGGTGTGTGTGTGTTTTAATGCCCTGCGCCATC SEQ ID NO.13

[0120] (2) The two DNA fragments are amplified into a fragment using a bridge PCR, i.e., the first functional region, and the forward primer of the second function zone are amplified in the forward pri...

Embodiment 3

[0149] Example 3 HBD-MNASE activity detection

[0150] Put different amounts of HBD-MNase (in the amount of input Figure 5 The shown) mixed with 550 ng genome DNA, add CA 2+ The final concentration was 10 mm, and the ice bath was 10 min. Agarose gel electrophoresis detection showing HBD-MNase to cut genomic DNA enzymes into a 100 bp size DNA fragment, as a result Figure 5 As shown: under the input of the same genome (550 ng), as the amount of the fusion protein HBD-MNase input of the present invention increases (from 0 ng to 578.4 ng), it will be apparent that the genome strip gradually narrows and even disappeared. In the lower side of the lane, a gradually increasing genome, and the results of the in vitro enzyme except that the fusion protein HBD-MNase of the present invention has a relatively enzymatic activity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fusion protein for preparing a single-cell in-situ active R-loop library and application of the fusion protein. The fusion protein relates to a R-loop specific binding protein HBD, an MNase nuclease and a Tn5 transposase. The fusion protein is mainly used for R-loop detection and high-throughput library construction. The fusion protein is used for R-loop detection and high-throughput library construction, in-situ active R-loop detection can be achieved, the library construction efficiency can be improved, the library background can be reduced, the accuracy of the R-loop detection technology can be improved, and the R-loop detection process can be simplified.

Description

Technical field [0001] The present invention relates to the field of biotechnology, and in particular to a fusion protein and its applications. Background technique [0002] The R-Loop (R ring) is a three-stranded nucleic acid structure, that is, one of the RNA strands and the binding chain of the double-stranded DNA, and another DNA chain is empty and an RNA: DNA heterozygous chain forms a cyclic structure. In the past, R-LOOP length was considered to be harmful to cells, and more concerned is less. In recent years, as an important component on the cellular genome, R-LOOP is involved in many biological functions and became an important research area of ​​epigenetic genetics. Currently, there are mostly a DRIP-SEQ and DRIP-SEQ-SEQ-SEQ-SEQ that detects R-LOOP. [0003] DRIP-SEQ ((DNA: RNA Hybrid ImmunopRecipitation and Sequencing) is a specific identification DNA: an immunopolyzer and high-throughput sequencing analysis technique based on RNA heterozygous antibody, has been used t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/00C12N9/22C12N9/12C40B50/06C12Q1/6869
CPCC07K14/00C12N9/22C12N9/1241C40B50/06C12Q1/6869C12Q2535/122C12Q2521/327C12Q2543/10
Inventor 姚红杰李尧益王新秀黄赛南
Owner GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI