Fusion protein and application thereof
A technology of fusion protein and protein, which is applied in the field of fusion protein and its application, can solve the problems of scarcity of R-loop means, lack of chain-specific information, and long time required for the process, so as to improve specificity, specificity recognition and Capturing and Simplifying the Effects of the Experimental Process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0070] First, HBD-MNase fusion protein design, expression and purification
[0071] 1. Construct an HBD-MNase fusion protein expression vector
[0072] (1) Amplified the first functional area (SEQ ID NO.1) and the second functional area (SEQ ID NO. 2) PCR by primers. The primers are as follows:
[0073] The first functional area forward primers:
[0074] Atgggtcggigatccgaattcatgttctatgcggggggaggag seq ID no.7
[0075] The first functional area reverse primer:
[0076] Gaactcccccgtcatcaaaaggcccaggcctcatctt seq ID no.8
[0077] The second functional area forward primers:
[0078] Gatgacgataaggagttcgcaacttcaactaaaaaattaca seq ID no.9
[0079] Second functional area reverse primers:
[0080] GGTGGTGTGGTGTGTGTGTGTGTGTGTGTGTCGTTTTGTGACCTGAATCAGCGTTGTC SEQ ID NO.10
[0081] (2) The two DNA fragments are amplified into a fragment using a bridge PCR, i.e., the first functional region, and the forward primer of the second function zone are amplified in the forward primers and reverse primer...
Embodiment 2
[0109] Example 2 Design, Expression and Purification of HBD-TN5 fusion proteins
[0110] 1. Construct an HBD-TN5 fusion protein expression vector
[0111] (1) Amplification of the first functional area (SEQ ID NO.1) and the second functional area (SEQ ID NO. 3) PCR, respectively. The primers are as follows:
[0112] The first functional area forward primers:
[0113] Atgggtcggigatccgaattcatgttctatgcggggggaggag seq ID no.7
[0114] The first functional area reverse primer:
[0115] GGCTTTAGCCGCTGCCCCCTTTGCGCAGCAAAAGGCCCAGGCCCATCTT SEQ ID NO.11
[0116] The second functional area forward primers:
[0117] Gctgccgcaaaggaggcagcggggctaaagccatgattaccagtgcactgca seq ID NO.12
[0118] Second functional area reverse primers:
[0119] GGTGGTGTGGTGGTGTGTGTGTGTTTTAATGCCCTGCGCCATC SEQ ID NO.13
[0120] (2) The two DNA fragments are amplified into a fragment using a bridge PCR, i.e., the first functional region, and the forward primer of the second function zone are amplified in the forward pri...
Embodiment 3
[0149] Example 3 HBD-MNASE activity detection
[0150] Put different amounts of HBD-MNase (in the amount of input Figure 5 The shown) mixed with 550 ng genome DNA, add CA 2+ The final concentration was 10 mm, and the ice bath was 10 min. Agarose gel electrophoresis detection showing HBD-MNase to cut genomic DNA enzymes into a 100 bp size DNA fragment, as a result Figure 5 As shown: under the input of the same genome (550 ng), as the amount of the fusion protein HBD-MNase input of the present invention increases (from 0 ng to 578.4 ng), it will be apparent that the genome strip gradually narrows and even disappeared. In the lower side of the lane, a gradually increasing genome, and the results of the in vitro enzyme except that the fusion protein HBD-MNase of the present invention has a relatively enzymatic activity.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


