Supercharge Your Innovation With Domain-Expert AI Agents!

Gene polymorphism detection kit for second-generation antipsychotic drug metabolism marker as well as detection method and applicationof gene polymorphism detection kit

A technology for antipsychotic drugs and detection kits, which can be used in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., and can solve problems such as cumbersome operations and time-consuming

Pending Publication Date: 2021-12-07
菲思特(上海)生物科技有限公司
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the methods of obtaining blood DNA mainly include traditional column extraction and magnetic bead extraction, both of which are time-consuming and cumbersome to operate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene polymorphism detection kit for second-generation antipsychotic drug metabolism marker as well as detection method and applicationof gene polymorphism detection kit
  • Gene polymorphism detection kit for second-generation antipsychotic drug metabolism marker as well as detection method and applicationof gene polymorphism detection kit
  • Gene polymorphism detection kit for second-generation antipsychotic drug metabolism marker as well as detection method and applicationof gene polymorphism detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1, the preparation of kit

[0042] (1) Specific primer design

[0043] The kit of the present invention designs specific amplification primers and sequencing primers for the ANKKI (2317G>A) gene polymorphism, and is used for pyrophosphate PCR detection. The gene polymorphism sequence is subject to the public sequence in Genebank, and the primer sequences are shown in Table 1 below.

[0044] Table 1

[0045] Primer name SEQ ID sequence mark ANKKI(2317G>A)-F1 1 GACGGCTCCTTGCCCCTCTAGGAAGGACATG 5`Biotin ANKKI(2317G>A)-R1 2 GCGGTCCAGAGGAGCACCTTCCTGAGTGTC ANKKI(2317G>A)-S1 3 CATCCTCAAAGTGCTG ANKKI (2317G>A) sequence to be tested 4 GTCRAGGCAGGCGCCCAGCTGGACGTCCA ANKKI (2317G>A) distribution instructions 5 CGTGCGAGCA

[0046] (2) Kit composition

[0047] The detection kit includes the components shown in Table 2 below:

[0048] Table 2 Kit component list

[0049] serial number Compon...

Embodiment 2

[0059] Embodiment 2, kit detection steps

[0060] The instruments adopted in the present invention are as follows: thermostat, pyrosequencer (Wuhan First Biotechnology Co., Ltd.).

[0061] 1) Take 30 μL EDTA anticoagulated whole blood sample in a PCR amplification tube;

[0062] 2) Add 100 μL of sample treatment solution and 4ul of magnetic beads, and let stand for 5 minutes;

[0063] 3) Place the PCR amplification tube on the magnetic stand, and suck out the mixed solution from the opposite side of the magnetic beads after all the magnetic beads are adsorbed to one side;

[0064] 4) Add amplification reagent 1 into the dry powder of amplification reagent 2, fully dissolve and mix;

[0065] 5) Add 25ul of the prepared PCR reaction solution to the PCR amplification tube obtained in step 4), fully mix the magnetic beads with the PCR reaction solution, centrifuge, and perform a constant temperature reaction;

[0066] 6) Amplify using a PCR instrument, the reaction system is 25...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a gene polymorphism detection kit for a second-generation antipsychotic drug metabolism marker as well as a detection method and application of the gene polymorphism detection kit. The detection kit is characterized in that a specific amplification primer and a sequencing primer are designed aiming at the polymorphism of ANKKI 2317G > A, the kit comprises the following components: a sample treating fluid, magnetic beads, an amplification reagent 1, an amplification reagent 2, an ANKKI (2317G > A) sequencing primer and a positive control. The gene polymorphism detection kit is mainly optimized from two aspects: on one hand, a mode of extracting and amplifying in a same tube is adopted, so that the risk of nucleic acid loss due to repeated tube transfer during extraction is avoided; on the other hand, rapid isothermal amplification is carried out by adding an anti-inhibitor; the gene polymorphism detection kit aims to detect the gene polymorphism of the second-generation antipsychotic drug by combining rapid DNA preparation, constant-temperature PCR amplification and pyrosequencing technologies, and provides suggestions from the gene perspective for clinical personalized medication.

Description

technical field [0001] The invention relates to a gene polymorphism detection kit for metabolic markers of second-generation antipsychotic drugs, a detection method and application thereof, and belongs to the field of gene detection. Background technique [0002] Second-generation antipsychotics are often referred to as atypical antipsychotics, or 5-HT / DA antagonists. Its main pharmacological effect is to block D2 receptors, and it can also block 5-HT receptors. It has therapeutic effects on both negative symptoms and positive symptoms, and has fewer extrapyramidal reactions than the first-generation antipsychotics. Clozapine, olanzapine, risperidone, quetiapine, aripiprazole, etc. are representative drugs. [0003] Ankyrin repeat and kinase domain containing 1 (ANKK1) is a member of the serine / threonine protein kinase family. The human ANKKI gene is located on chromosome 11 11q23.2, adjacent to the dopamine receptor D2 (dopamine receptor D2, DRD2) gene DRD2. The protein ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6869C12Q1/6844C12N15/11
CPCC12Q1/6883C12Q1/6869C12Q1/6844C12Q2600/106C12Q2600/156C12Q2565/301C12Q2521/507C12Q2522/101C12Q2531/119C12Q2563/143C12Q2563/149
Inventor 陈立波孙悦刘丹
Owner 菲思特(上海)生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More