Unlock instant, AI-driven research and patent intelligence for your innovation.
Gene polymorphism detection kit for second-generation antipsychotic drug metabolism marker as well as detection method and applicationof gene polymorphism detection kit
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology for antipsychotic drugs and detection kits, which can be used in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., and can solve problems such as cumbersome operations and time-consuming
Pending Publication Date: 2021-12-07
菲思特(上海)生物科技有限公司
View PDF4 Cites 1 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0005] At present, the methods of obtaining blood DNA mainly include traditional column extraction and magnetic bead extraction, both of which are time-consuming and cumbersome to operate
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0041] Embodiment 1, the preparation of kit
[0042] (1) Specific primer design
[0043] The kit of the present invention designs specific amplification primers and sequencing primers for the ANKKI (2317G>A) gene polymorphism, and is used for pyrophosphate PCR detection. The gene polymorphism sequence is subject to the public sequence in Genebank, and the primer sequences are shown in Table 1 below.
[0044] Table 1
[0045] Primer name SEQ ID sequence mark ANKKI(2317G>A)-F1 1 GACGGCTCCTTGCCCCTCTAGGAAGGACATG 5`Biotin ANKKI(2317G>A)-R1 2 GCGGTCCAGAGGAGCACCTTCCTGAGTGTC ANKKI(2317G>A)-S1 3 CATCCTCAAAGTGCTG ANKKI (2317G>A) sequence to be tested 4 GTCRAGGCAGGCGCCCAGCTGGACGTCCA ANKKI (2317G>A) distribution instructions 5 CGTGCGAGCA
[0046] (2) Kit composition
[0047] The detection kit includes the components shown in Table 2 below:
[0060] The instruments adopted in the present invention are as follows: thermostat, pyrosequencer (Wuhan First Biotechnology Co., Ltd.).
[0061] 1) Take 30 μL EDTA anticoagulated whole blood sample in a PCR amplification tube;
[0062] 2) Add 100 μL of sample treatment solution and 4ul of magnetic beads, and let stand for 5 minutes;
[0063] 3) Place the PCR amplification tube on the magnetic stand, and suck out the mixed solution from the opposite side of the magnetic beads after all the magnetic beads are adsorbed to one side;
[0064] 4) Add amplification reagent 1 into the dry powder of amplification reagent 2, fully dissolve and mix;
[0065] 5) Add 25ul of the prepared PCR reaction solution to the PCR amplification tube obtained in step 4), fully mix the magnetic beads with the PCR reaction solution, centrifuge, and perform a constant temperature reaction;
[0066] 6) Amplify using a PCR instrument, the reaction system is 25...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Property
Measurement
Unit
particle diameter
aaaaa
aaaaa
Login to View More
Abstract
The invention discloses a genepolymorphism detection kit for a second-generation antipsychoticdrugmetabolism marker as well as a detection method and application of the genepolymorphism detection kit. The detection kit is characterized in that a specific amplification primer and a sequencing primer are designed aiming at the polymorphism of ANKKI 2317G > A, the kit comprises the following components: a sample treating fluid, magnetic beads, an amplification reagent 1, an amplification reagent 2, an ANKKI (2317G > A) sequencing primer and a positive control. The genepolymorphism detection kit is mainly optimized from two aspects: on one hand, a mode of extracting and amplifying in a same tube is adopted, so that the risk of nucleic acid loss due to repeated tube transfer during extraction is avoided; on the other hand, rapid isothermal amplification is carried out by adding an anti-inhibitor; the gene polymorphism detection kit aims to detect the gene polymorphism of the second-generation antipsychoticdrug by combining rapid DNA preparation, constant-temperature PCR amplification and pyrosequencing technologies, and provides suggestions from the gene perspective for clinical personalized medication.
Description
technical field [0001] The invention relates to a gene polymorphism detection kit for metabolic markers of second-generation antipsychotic drugs, a detection method and application thereof, and belongs to the field of gene detection. Background technique [0002] Second-generation antipsychotics are often referred to as atypical antipsychotics, or 5-HT / DA antagonists. Its main pharmacological effect is to block D2 receptors, and it can also block 5-HT receptors. It has therapeutic effects on both negative symptoms and positive symptoms, and has fewer extrapyramidal reactions than the first-generation antipsychotics. Clozapine, olanzapine, risperidone, quetiapine, aripiprazole, etc. are representative drugs. [0003] Ankyrin repeat and kinase domain containing 1 (ANKK1) is a member of the serine / threonineproteinkinase family. The human ANKKI gene is located on chromosome 11 11q23.2, adjacent to the dopaminereceptor D2 (dopaminereceptor D2, DRD2) gene DRD2. The protein ...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
