Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleic acid detection reagent, kit and detection method for novel 2019 coronavirus lambda variant

A virus lambda and detection reagent technology, applied in the field of in vitro diagnostic reagents, can solve the problems of not meeting the needs of rapid screening of a large number of clinical samples, long detection cycle, cumbersome operation, etc., and achieve low cost, high speed and high sensitivity. Effect

Pending Publication Date: 2021-12-21
北京艾瑞克阳医疗科技有限公司
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the nucleic acid detection of SARS-CoV-2 is mainly based on the fluorescent quantitative PCR detection platform, which is convenient, fast, low-cost, and the detection results are accurate and reliable; As a result, the mutation type has a point mutation of a single base sequence, so it is difficult to develop such a detection reagent on the fluorescent quantitative PCR detection platform, and there is no such detection product on the market at present
The existing genetic detection methods for the typing detection of Lambda mutant strains are mainly next-generation sequencing (NGS), which has a long detection cycle, high cost, and cumbersome operations, which cannot meet the needs of rapid screening of a large number of clinical samples

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid detection reagent, kit and detection method for novel 2019 coronavirus lambda variant
  • Nucleic acid detection reagent, kit and detection method for novel 2019 coronavirus lambda variant
  • Nucleic acid detection reagent, kit and detection method for novel 2019 coronavirus lambda variant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1: Design of primers and probes

[0063] Specific primers and probes were designed according to the mutation sites of the spike protein-encoding gene of the 2019 novel coronavirus Lambda variant, and the specific primers and probes were for the mutation sites of G75V, T76I, Δ246-252, D253N, L452Q and F490S, respectively. The dot design is capable of distinguishing non-mutated 2019-nCoV from other virus strains. Wherein, specific primers and probes are as follows:

[0064] Primer F1 (SEQ ID NO.1): TGTCTCTGGGACCAATGTTATTAA

[0065] Primer R1 (SEQ ID NO.2): TGTTTTTGTGGTAATAAACACCCAA

[0066] Probe P1 (FAM-SEQ ID NO.3-BHQ):

[0067] FAM-CTAACATAATAAGAGGCTGGATT-BHQ

[0068] Primer F2 (SEQ ID NO.4): TACTTGCTTTACATAATTCTTCT

[0069] Primer R2 (SEQ ID NO.5): AACAATAGATTCTGTTGGTTGGACT

[0070] Probe P2 (VIC-SEQ ID NO.6-BHQ):

[0071] VIC-AACTGGAACCATTACAGATGCTGTA-BHQ

[0072] Primer F3 (SEQ ID NO.7): TGGTGGTAACTATAATTACCAGT

[0073] Primer R3 (SEQ ID NO.8): GACC...

Embodiment 2

[0076] Example 2: Detection of 2019 Novel Coronavirus Lambda Variant Nucleic Acid

[0077] (1) Materials, reagents, instruments: The extraction reagents used the magnetic bead method virus nucleic acid extraction reagents of Feipeng Biological Co., Ltd., and the primers and probes (designed according to Example 1) were entrusted to Shanghai Jierui Bioengineering Co., Ltd. to synthesize, and the RNA was fake The virus was custom-synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., and the fluorescent quantitative PCR instrument was ABI7500 from American Thermo Fisher.

[0078] (2) Specimen preparation: The positive specimen is a throat swab sample of inactivated virus after human infection with the 2019 novel coronavirus lambda variant; the negative control specimen is a throat swab sample of a healthy person. The above samples were all from a clinical unit.

[0079] (3) Nucleic acid extraction: Use a commercial magnetic bead virus nucleic acid extraction kit to extract ...

Embodiment 3

[0099] Example 3: Validation of Clinical Samples

[0100] (1) Materials, reagents, instruments: refer to Example 2.

[0101] (2) Specimen preparation: collect inactivated virus throat swab samples from 10 suspected patients who were clinically tested for nucleic acid as samples to be tested, and at the same time collect an inactivated virus confirmed to be infected with the 2019 novel coronavirus lambda variant Pharyngeal swab samples were used as positive reference samples, and throat swab samples from 5 healthy individuals were collected as negative reference samples. The above samples were all from a clinical unit.

[0102] (3) Nucleic acid extraction: use the magnetic bead method virus nucleic acid extraction kit to extract the nucleic acids of the sample to be tested, the positive reference product, and the negative reference product respectively, and then use them for PCR detection.

[0103] (4) PCR amplification: refer to Example 2.

[0104] (5) Contrast reagent: use...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a 2019 novel coronavirus (SARS-CoV-2) lambda variant nucleic acid detection reagent, a kit and a detection method, and belongs to the technical field of in-vitro diagnostic reagents. The detection reagent comprises specific primers and probes which are respectively designed for mutation sites of spinous process protein coding genes G75V, T76I, delta 246-252, D253N, L452Q and F490S of a Lambda variant, and can also comprise a one-step RT-PCR reaction solution, a positive reference substance and a negative reference substance. Based on the detection reagent, the advantages of high detection speed, high sensitivity and low cost of a fluorescent quantitative PCR platform are fully utilized, a novel simple, rapid, accurate and low-cost 2019 novel coronavirus lambda variant nucleic acid detection method is developed, and the defects of the prior art (Next Generation Sequencing, NGS) such as long time consumption, high cost and complex operation process in the aspect of Lambda variant typing detection are overcome, the clinical detection requirements of a large number of samples are met, and powerful technical support for epidemic prevention and control are provided.

Description

technical field [0001] The invention belongs to the technical field of in vitro diagnostic reagents, in particular to a 2019 novel coronavirus (SARS-CoV-2) Lambda (Lambda) variant strain nucleic acid detection reagent, kit and detection method. Background technique [0002] The Lambda mutant strain is one of the important strains among the many mutant strains of the 2019 novel coronavirus (SARS-CoV-2). A mutated virus that was upgraded to "need attention". [0003] Through the analysis of the nucleic acid sequence diversity of SARS-CoV-2, it was found that compared with the wild-type SARS-CoV-2, the most important change of the Lambda variant was the nucleotide sequence of the gene encoding the spike protein (Spike protein). Multiple base mutations, the typical mutation sites are: G75V, T76I, Δ246-252, D253N, L452Q, F490S, etc. Through the analysis of the sequence diversity of SARS-CoV-2 in the GISAID EpiCoV database, it was found that the mutation sites G75V, T76I, Δ246-2...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6851C12Q2600/156C12Q2600/16C12Q2531/113C12Q2537/143C12Q2521/107C12Q2563/107
Inventor 蒋小琴杨仲钦
Owner 北京艾瑞克阳医疗科技有限公司