Cotton GhLAC4 coding gene, cotton disease-resistant module miR397-LAC4 and application
A technology of mir397-lac4 and ghr-mir397, applied in cotton GhLAC4 encoding gene, cotton disease resistance module miR397-LAC4 and application fields, can solve the problems of disease resistance function and its mechanism that have not yet been reported, and achieve enhanced resistance to Verticillium wilt disease performance, and the effect of improving the resistance to verticillium wilt
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] This embodiment specifically discloses the cloning and expression analysis of the cotton GhLAC4 coding gene, and the process is as follows:
[0046] 1. Extraction of total RNA and synthesis of cDNA first strand
[0047] The cotton seeds that have been develored by sulfuric acid are soaked in water, placed in an incubator at 37°C overnight, and transferred to an incubator on the next day, and germinated in a dark place while keeping the seeds moist. The seeds that germinated consistently were transferred to a culture box containing Hoagland's nutrient solution, and cultivated in a 28°C greenhouse with a photoperiod of 16h light / 8h dark incubator. After the cotton seedlings grew true leaves, the root, stem and leaf samples of the cotton seedlings were picked respectively, and the cotton RNA was extracted using the column plant total RNA isolation and purification kit. The synthesis of the first strand of cDNA was carried out according to the instructions of the EasyScrip...
Embodiment 2
[0064] This example specifically discloses that ghr-miR397 regulates the target gene GhLAC4 after transcription, and the specific steps are as follows:
[0065] 1. Construction of PCAMBIA1300-miR397 expression vector
[0066] Cotton DNA was extracted with a plant DNA extraction kit, using the extracted DNA as a template, the forward and reverse primers were (F: GGATACATGTACGTAACGCGTAATTTACTTTTCAATTGTTCCAAAGG and R: TGCTTCGAATTCATCAATGCAGCTTTGAATGAAGAACTCTT) respectively to amplify the ghr-miR397 precursor gene, and the amplification conditions were: 95°C , 5min; 95°C, 30s; 60°C, 30s; 72°C, 30s; 35 cycles. The amplified product was inserted into expression vector PCAMBIA1300 to construct PCAMBIA1300-miR397 expression vector.
[0067] 2. Construction of pBI121-GhLAC4 and pBI121-GhLAC4 mu carrier
[0068] Using cotton cDNA as a template, add forward primer GhLAC4-F (GAGAACACGGGGGACTCTAGAATGGAGATGGCACCATGGATTC), introduce Xba I restriction enzyme site and reverse primer GhLAC4-...
Embodiment 3
[0076] In order to study the disease resistance function of the miR397-LAC4 module in terrestrial cotton, this example specifically discloses the effects of ghr-miR397 and GhLAC4 gene silencing and overexpression plants on resistance to Verticillium dahliae.
[0077] 1. Cultivation of virus-induced gene silencing (VIGS) plants
[0078] 1.1 Construction of virus silencing vector TRV: STTM397
[0079] Chemically synthesized by Beijing Qingke Biotechnology Co., Ltd., STTM397 (GA GGATCC TAACTCACGTGACCGCAACTTGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAATTAACTCACGTGACCGCAACTACTT GGTACC CTC), the restriction sites BamH I and KpnI were added to the 5' end and 3' end of the STTM397 synthetic fragment respectively. The STTM397 synthetic fragment was digested and inserted into the viral vector pYL156 to construct the silencing vector TRV:STTM397 vector.
[0080] 1.2 Construction of viral overexpression vector TRV:OE-miR397
[0081] Using cotton DNA as a template, the forward prim...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


