Construction method and application of litchi transgenic system
A construction method and transgenic technology, which is applied in the field of construction of litchi transgenic system, can solve the problems that litchi is not resistant to storage and transportation, low yield stability, and the transgenic system of litchi seedlings has not been reported yet.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 Acquisition of lychee seedlings
[0028] First, the disinfection method of lychee seeds: buy lychees in the market, first peel off the pulp of mature lychee seeds, wash them with water, and remove excess pulp. On the suprast bench, soak the washed seeds in 75% alcohol for 2 min, rinse them with sterile water (using an autoclave at 121 °C, 15 min), and place the seeds in 3% NaClO 3 (The NaClO to be purchased.) 3 , dilute with sterile water to a concentration of 2%) for 30 min, rinse with sterile water 4-5 times, and then seed seeding in 1 / 2 MS (1 / 2 MS basal medium (coolaber), 7 g / L agar powder, pH = 5.7) medium in a flask with one seed in each flask. This disinfection method can achieve a lychee seed contamination rate of zero.
[0029] Second, the cultivation of lychee seeds: the culture bottle is placed in the culture biochemical incubator, and the cultivation conditions are: temperature 24 °C, dark culture for 8 h, light culture for 16 h.
Embodiment 2
[0030]Example 2 Culture of Agrobacterium
[0031] A clone of the Cauliflower Mosaic Virus (CaMV) 35S promoter (subsequently abbreviated as pro35S):
[0032] The upstream and downstream primers for the pro35S full-length sequence designed using Primer Premier 5.0 software are as follows: 35S-F: CATGGAGTCAAAGATTCAAATAGAG (SEQ ID NO.:1), 35S-R: AGTCCCCCGTGTTCTCTCCAAATG (SEQ IDNO.:)2, using ApexHF HS DNA Polymerase FS Master Mix performs amplification of the pro35S full-length sequence. The PCR reaction system was: 98 °C pre-denaturation for 3 min, 98 °C denaturation for 10 s, annealing temperature 55 °C, 30 s, 72 °C extension for 1 min, a total of 35 cycles, 72 °C continued to extend for 2 min. After the end of the reaction, take 1 μLPCR product, perform agarose gel electrophoresis detection, and send it to Aiji Biotech for sequencing. The sequence of pro35S promoters is: CATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACA...
Embodiment 3
[0042] Example 3 Infestation
[0043] Experimental group
[0044] On the suprabacter table, a Liquid (OD) of Ar. Qual F. rhigenensis containing the pro35S:RUBY plasmid will be placed 600 Values approximately equal to 0.6) are injected, respectively, through a 1 ml syringe, into the stems of lychee seedlings growing in culture flasks as Figure 1 The seedling period of lychee seedlings is 25 days, in order to avoid too much bacterial liquid falling on the medium to contaminate the medium and plant, first hang a small drop of bacterial liquid on the stem through the syringe, and then through the needle of the syringe, poke the wound on the stem of the part of the lychee seedling that hangs the bacterial liquid, so that the bacterial liquid infects into the lychee stem, due to the large number of lychee phenols, after 30 minutes of light avoidance, the bacterial liquid should be shaken off, and the bacterial liquid will be re-injected into the same wound, and the bacterium liquid will...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More