Apolygus lucorum GRK gene, dsRNA thereof, and synthetic method and application thereof
A synthesis method and technology for Lygus chinensis are applied in the efficient synthesis of its dsRNA and its dsRNA, in the field of Lygus chinensis GRK gene, and can solve the problems of high cost, inability to develop normally, affecting the normal development of insects, etc., so as to achieve control of population number, A wide range of effects with significant lethal effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] The acquisition of the Lygus green bug GRK gene sequence, through the following steps:
[0042] 1. Based on the transcriptome data of Lygus viridans, use the Primer Premier5.0 software to design cloning primers. The primer sequences are as follows:
[0043] Upstream primer SEQ ID NO.3: ATGGCAGATTTGGAGGCTGT
[0044] Downstream primer SEQ ID NO.4: TCAGTTTCCATTGGTCGTTC
[0045] Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd.
[0046] 2. Using the Trizol method to extract the total RNA of Lygus aeruginosa and reverse transcription to obtain the cDNA template:
[0047] Healthy growth and development of 4th instar nymphs of Lygus viridatus were selected as samples, and 5 nymphs were used as a biological replicate, which were quickly frozen in liquid nitrogen. Grinding was performed using an electric grinder, and total RNA was extracted according to TRIzol Reagent (TIANGEN, Beijing); the first-strand cDNA was synthesized according to the reverse transcr...
Embodiment 2
[0056] Example 2 The efficient synthesis of the dsRNA of the Lygus green bug GRK gene
[0057] Select a section of the nucleotide sequence of the Lygus green bug GRK gene as the preparation of dsRNA, and its nucleotide sequence is shown in SEQID NO.5.
[0058] 1. Design of the dsRNA primers of the Lygus green bug GRK gene
[0059] Using CE Design software, add homologous sequences with L4440 to both ends of the target gene fragment, and design PCR amplification primers. The upstream primer contains a Pst I restriction site, and the downstream primer Nhe I restriction site. The sequence is as follows:
[0060] Upstream primer GRK-dsRNA-F: SEQ ID NO.6
[0061] tccaccggttccatg gctagc GGTTTGGAGAAGTTTACGGCTG
[0062] Downstream primer GRK-dsRNA-F: SEQ ID NO.7
[0063] cttgatatcgaattc ctgcag ATGAGAAGGAGTCGGGAAGCTC
[0064] The lowercase letters are the homologous sequences on the L4440 vector, and the underlined part represents the restriction site; the primers were synthesi...
Embodiment 3
[0085] The lethal effect of the dsRNA of embodiment 3 Lygus green bug GRK gene
[0086] 1. Injection of dsRNA
[0087] Select 30 healthy, 3rd-instar nymphs of the same age and inject 500ng dsGRK into the basal fossa of the thoracic feet by microinjection, and set up 3 biological repetitions as the treatment group; select the same nymphs and inject 500ng dsGFP and the same nymphs without treatment group were selected, and three biological replicates were set up as the control group.
[0088] 2. Detection of silencing of the GRK gene of Lygus aeruginosa
[0089] The relative expression levels of GRK gene and internal reference gene β-actin were detected by qPCR technology, and 2 -ΔΔCt Calculation of the silencing detection of the GRK gene of Lygus aeruginosa using the method. Reaction system (20 μL): 10 μL of SYBR Green Master Mix (YEASEN, Shanghai), 0.4 μL of upstream and downstream primers (10 pmol / L), 2 μL of cDNA template, RNase-free H 2 O 7.2 μL. Reaction program: 95°C...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com