Supercharge Your Innovation With Domain-Expert AI Agents!

Apolygus lucorum GRK gene, dsRNA thereof, and synthetic method and application thereof

A synthesis method and technology for Lygus chinensis are applied in the efficient synthesis of its dsRNA and its dsRNA, in the field of Lygus chinensis GRK gene, and can solve the problems of high cost, inability to develop normally, affecting the normal development of insects, etc., so as to achieve control of population number, A wide range of effects with significant lethal effects

Pending Publication Date: 2022-01-18
JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

G protein-coupled receptor kinase (G Protein-Coupled Receptor Kinase, GRK) is an important class of membrane proteins, which can be phosphorylated by 20E. Allergic reaction, resulting in the inability of G protein to combine with GRK, thus affecting the normal development of insects
[0005] Therefore, designing dsRNA by obtaining the GRK gene of the green Lygus stinkbug and using RNAi technology to inhibit the expression of the GRK gene will cause it to fail to develop normally and eventually die.
However, at present, the main means of synthesizing dsRNA is the T7 kit, which has high cost and low synthesis amount, and cannot be mass-produced

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Apolygus lucorum GRK gene, dsRNA thereof, and synthetic method and application thereof
  • Apolygus lucorum GRK gene, dsRNA thereof, and synthetic method and application thereof
  • Apolygus lucorum GRK gene, dsRNA thereof, and synthetic method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] The acquisition of the Lygus green bug GRK gene sequence, through the following steps:

[0042] 1. Based on the transcriptome data of Lygus viridans, use the Primer Premier5.0 software to design cloning primers. The primer sequences are as follows:

[0043] Upstream primer SEQ ID NO.3: ATGGCAGATTTGGAGGCTGT

[0044] Downstream primer SEQ ID NO.4: TCAGTTTCCATTGGTCGTTC

[0045] Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd.

[0046] 2. Using the Trizol method to extract the total RNA of Lygus aeruginosa and reverse transcription to obtain the cDNA template:

[0047] Healthy growth and development of 4th instar nymphs of Lygus viridatus were selected as samples, and 5 nymphs were used as a biological replicate, which were quickly frozen in liquid nitrogen. Grinding was performed using an electric grinder, and total RNA was extracted according to TRIzol Reagent (TIANGEN, Beijing); the first-strand cDNA was synthesized according to the reverse transcr...

Embodiment 2

[0056] Example 2 The efficient synthesis of the dsRNA of the Lygus green bug GRK gene

[0057] Select a section of the nucleotide sequence of the Lygus green bug GRK gene as the preparation of dsRNA, and its nucleotide sequence is shown in SEQID NO.5.

[0058] 1. Design of the dsRNA primers of the Lygus green bug GRK gene

[0059] Using CE Design software, add homologous sequences with L4440 to both ends of the target gene fragment, and design PCR amplification primers. The upstream primer contains a Pst I restriction site, and the downstream primer Nhe I restriction site. The sequence is as follows:

[0060] Upstream primer GRK-dsRNA-F: SEQ ID NO.6

[0061] tccaccggttccatg gctagc GGTTTGGAGAAGTTTACGGCTG

[0062] Downstream primer GRK-dsRNA-F: SEQ ID NO.7

[0063] cttgatatcgaattc ctgcag ATGAGAAGGAGTCGGGAAGCTC

[0064] The lowercase letters are the homologous sequences on the L4440 vector, and the underlined part represents the restriction site; the primers were synthesi...

Embodiment 3

[0085] The lethal effect of the dsRNA of embodiment 3 Lygus green bug GRK gene

[0086] 1. Injection of dsRNA

[0087] Select 30 healthy, 3rd-instar nymphs of the same age and inject 500ng dsGRK into the basal fossa of the thoracic feet by microinjection, and set up 3 biological repetitions as the treatment group; select the same nymphs and inject 500ng dsGFP and the same nymphs without treatment group were selected, and three biological replicates were set up as the control group.

[0088] 2. Detection of silencing of the GRK gene of Lygus aeruginosa

[0089] The relative expression levels of GRK gene and internal reference gene β-actin were detected by qPCR technology, and 2 -ΔΔCt Calculation of the silencing detection of the GRK gene of Lygus aeruginosa using the method. Reaction system (20 μL): 10 μL of SYBR Green Master Mix (YEASEN, Shanghai), 0.4 μL of upstream and downstream primers (10 pmol / L), 2 μL of cDNA template, RNase-free H 2 O 7.2 μL. Reaction program: 95°C...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses apolygus lucorum G protein coupled receptor kinase. The amino acid sequence of the apolygus lucorum G protein coupled receptor kinase is shown as SEQ ID NO: 2. The invention also discloses a gene for encoding the apolygus lucorum G protein coupled receptor kinase as well as an acquisition method and application thereof. The invention further discloses dsRNA of the apolygus lucorum GRK gene and application thereof. The dsRNA of the synthesized GRK gene has a remarkable lethal effect on the apolygus lucorum, the population number of the apolygus lucorum is effectively controlled, and a new way is provided for pest control. Meanwhile, the dsRNA is synthesized by using escherichia coli, so that a product can be synthesized in a large scale within a short time, and the defect that a kit cannot synthesize a large amount of dsRNA is overcome. Meanwhile, the apolygus lucorum G protein coupled receptor kinase is low in cost, wide in application range, easy to operate, capable of being repeatedly used and free of limitation.

Description

technical field [0001] The invention relates to the technical field of agricultural pest control, in particular to a high-efficiency synthesis method and application of a Lygus lygus GRK gene, its dsRNA and its dsRNA. Background technique [0002] The green mirid bug Apolygus lucorum (Hemiptera: Miridae) belongs to the Miridae family of Hemiptera, and is an important pest on various crops such as cotton, vegetables, and fruit trees. In recent years, due to the adjustment of my country's agricultural industry structure and other reasons, the trend of damage to various crops has become more serious. In addition, the long-term dependence on chemical pesticide control has led to the increasing resistance of the green Lygus, causing huge economic losses to my country's agriculture. At present, the prevention and control of Lygus japonica in agricultural production is facing severe challenges, and it is urgent to develop new pollution-free prevention and control methods to reduce ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/70C12N15/89
CPCC12N9/12C12N15/70C12N15/89C12Y207/11016
Inventor 谭永安肖留斌乔恒赵静姜义平张杰钰
Owner JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More