Ribosomal protein L9e, a lethal gene fragment of SBPH and its application
A technology of gene fragments and striatellus, applied in the field of agricultural biology, can solve the problems of environmental pollution, poor control effect of chemicals, etc., and achieve the effect of low synthesis cost, significant lethal effect, and convenient large-scale application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] 1. Cloning method of Ribosomal protein L9e gene fragment:
[0037] (1) Get 10-20 heads of SBPH, and use the TRIzol method to extract total RNA;
[0038] (2) Synthesizing the first strand of cDNA;
[0039] (3) Obtain the gene fragment sequence from the SBPH transcriptome, in http: / / www.ncbi.nlm.nih.gov / After the homology comparison, it was predicted to be the Ribosomal protein L9e gene of S. striatellus. Using Primer premier 5.0 software, P 1 and P 2 were designed and amplified by RT-PCR;
[0040] Upstream primer (P1): 5'GTTATCGTTGCGTCTGTT 3'(SEQ ID NO.2),
[0041] Downstream primer (P 2): 5'GCGCCATTCGCACCCTTC 3' (SEQ ID NO.3);
[0042] PCR conditions are: denaturation at 94°C for 2min, 30sec at 94°C, 30sec at 55°C, 30sec at 72°C, 35 cycles, extension at 72°C
[0043] PCR reaction system (50μL):
[0044]
[0045] (4) The PCR product is separated by agarose gel electrophoresis, and the target DNA fragment is recovered;
[0046](5) Insert the recovered target fra...
Embodiment 2
[0050] Embodiment 2.dsRNA synthesis and recovery
[0051] (1) According to the verified Ribosomal protein L9e gene fragment sequence, use Primer Premier5.0 software to design P3 and P4;
[0052] Upstream primer (P3): 5'TAATACGACTCACTATAGGGTATCGTTGCGTCTGTTT 3'(SEQ ID NO.5)
[0053] Downstream primer (P4): 5'TAATACGACTCACTATAGGGTACCGACTTTGTCCATTAG 3'(SEQ ID NO.6)
[0054]
[0055] PCR conditions: Denaturation at 94°C for 2min, 30sec at 94°C, 30sec at 60°C, 30sec at 72°C, 38 cycles, extension at 72°C.
[0056] (2) The PCR product was separated by electrophoresis on a 1% low-melting point agarose gel and observed under ultraviolet light. The sequence is shown in SEQ ID NO.4.
[0057] (3) Using Promega's SV Gel and PCR Clean-Up System kit for recovery:
[0058] ① Cut the gel of the separated target fragment, put it into a 1.5ml microcentrifuge tube that has been weighed in (a), weigh (b) again, and calculate the weight of the cut gel in b-a;
[0059] ② According to the gel...
Embodiment 3
[0068] Example 3 Planthopper feeding dsRNA experiment
[0069] (1) Seal one end of the glass tube with a parafilm, absorb second-instar planthoppers (BPH, BPH) into different glass tubes with an insect sucker, and seal the other end with gauze;
[0070] (2) Gently pat the insects to one end with your hands, remove the gauze from the other end, and put the prepared parafilm sticker face up, pull evenly to both sides, pull it into a square, and then cover it on the glass On the nozzle of the tube, place the tube upright on the ultra-clean table;
[0071] (3) Use a pipette gun to draw 100 μl of feed and drop it in the center of the parafilm. The control group only adds feed (see Table 2 for formula), and the treatment group adds dsRNA of Ribosomal protein L9e gene to the feed. The dsRNA concentration is 3400ng / μl. A new parafilm, with the sticker side down, is attached to the mouth of the glass tube, and the feed and dsRNA are sealed between the two layers of parafilm;
[0072]...
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


