In-vitro culture method for efficiently inducing polarization of macrophages

A technology of in vitro culture of macrophages, applied in the field of biomedicine, can solve the problems of lack of systematic research and insufficient elaboration, and achieve the effect of high stability and high induction efficiency

Pending Publication Date: 2022-01-28
NANTONG UNIVERSITY
2 Cites 0 Cited by

AI-Extracted Technical Summary

Problems solved by technology

[0006] At present, the model of PMA-induced THP-1 monocyte differentiation into macrophages is widely used, but the concentration and time of PMA, the combination of cytokines that induce polarization, the concentration and time, these factors have a great impact on the final cell quality ...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Method used

[0064] On the existing traditional model of PMA-induced THP-1 monocyte differentiation into macrophages, differentiation and polarization often fail, and there are huge differences between experimental batches. The reason is that the large concentration of inducer used, the use of animal serum in the cultivation process, and the unevenness of experimental parameters such as induction time account for a large factor. In the present invention, animal serum is not used in the induction process, and the induction effects of different inducer combinations are comparative...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Abstract

The invention discloses an in-vitro culture method for efficiently inducing polarization of macrophages, wherein the method comprises the following steps: step 1, under a serum-free condition, stimulating THP-1 mononuclear cells with PMA and GM-CSF to differentiate the THP-1 mononuclear cells into macrophages; step 2, inducing the macrophages differentiated in the step 1 for 24 hours by using 20 ng/mL of IFN-gamma and 100 ng/mL of LPS to obtain M1 type macrophages; and step 3, inducing the macrophages differentiated in the step 1 for 24 hours by using 20 ng/mL of IL-4 and 20 ng/mL of IL-10 to obtain M2 type macrophages. According to the invention, an economic and perfect model in which a THP-1 mononuclear cell line is induced to differentiate into the macrophages and then polarized is adopted, and through detection of a plurality of markers (CD11b, CD86, CD206, iNOS, CD206, Agr-1 and IL-1beta), the macrophages induced to differentiate and polarized M1 and M2 type macrophages are identified.

Application Domain

Technology Topic

Image

  • In-vitro culture method for efficiently inducing polarization of macrophages
  • In-vitro culture method for efficiently inducing polarization of macrophages
  • In-vitro culture method for efficiently inducing polarization of macrophages

Examples

  • Experimental program(5)

Example Embodiment

[0031] Example 1
[0032] THP-1 is a monocytic leukemia cell, and monocyte-derived macrophages highly express CD11b, and THP-1 cells undergo significant changes in morphology after being induced to differentiate into macrophages, from nearly round suspension cells to Multi-projectile adherent cells.
[0033] The present invention uses a real-time quantitative gene amplification fluorescence detection system (q-PCR) to detect the expression of CD11b in cells and analyze the morphology of cells to identify the situation in which THP-1 cells are induced to differentiate into macrophages.
[0034] Firstly, verify the most appropriate dosage of PMA: set up PMA treatment groups with different concentration gradients, blank (PMA concentration 0) as negative control, q-PCR to detect the expression of CD11b in cells, the primer sequences used are shown in Table 1; MTT method is also used for detection cell viability.
[0035] The results of this experiment see figure 2 A and figure 2 B, from figure 2 A It can be seen that the expression of CD11b in THP-1 cells increases with the increase of PMA concentration, and the expression of CD11b increases significantly after being induced by 100 ng/mL PMA, and the expression of CD11b tends to be balanced when the concentration of PMA is higher than 100 ng/mL , and there was no significant difference in CD11b expression at 24 h and 48 h induced by PMA; figure 2 B It can be seen that when PMA was induced for 24 hours and the induction concentration was not higher than 100 ng/mL, the cell survival rate was high, and the cell survival rate gradually decreased with the prolongation of PMA induction time and the increase of concentration.
[0036] Based on the above results, it can be proved that the PMA concentration of 100 ng/mL and induction for 24 h are more suitable experimental conditions.

Example Embodiment

[0037] Example 2
[0038] On the basis of the experiment in Example 1, to verify the effect of GM-CSF on THP-1-induced differentiation into macrophages, in the case of adding a certain concentration of PMA and inducing for 24 h, at the same time set the group of adding different concentration gradients of GM-CSF, Detect the expression of CD11b and the survival rate of cells, see the results figure 2 C and figure 2 d. from figure 2 C and figure 2 In D, it can be seen that when the concentration of GM-CSF is higher than 5 ng/mL, the expression of CD11b in cells increases significantly, far exceeding the induction effect of PMA alone. With the further increase of GM-CSF concentration, the cell viability gradually decreases .
[0039] Therefore, it is inferred that 100 ng/mL PMA and 10 ng/mL GM-CSF co-induced the degree of differentiation and cell activity of macrophages obtained by co-induction for 24 h is more suitable, which can be used as the culture conditions for THP-1 cells to induce differentiation into macrophages.
[0040] Under an inverted optical microscope, THP-1 cells, macrophages induced by 100 ng/mL PMA for 24 h, and macrophages induced by 100 ng/mL PMA and 10 ng/mL GM-CSF for 24 h were observed and photographed. Use Image J software to measure the cell area and cell elongation factor (the length of the major axis of the cell divided by the length of the minor axis), the results are as follows image 3 shown.
[0041] The experimental results confirmed that after induction, the cells changed from a suspended nearly spherical shape to an adherent multi-protrusion shape, the cell area was significantly increased, and the cell elongation factor was significantly increased, indicating that the suspended THP-1 cells differentiated towards macrophages. Among them, The changes in cell morphology were more obvious after simultaneous induction of PMA and GM-CSF, that is, the characteristics of macrophage differentiation were more obvious.
[0042] In summary, it was determined that 100 ng/mL PMA and 10 ng/mL GM-CSF co-induced for 24 hours were the culture conditions for THP-1 cells to induce differentiation into macrophages.

Example Embodiment

[0043] Example 3
[0044] The present invention designs a method for detecting changes in the level expression of macrophage marker genes by q-PCR to identify macrophage polarization models.
[0045] The present invention screens out 5 genes that are closely related to macrophage polarization: IL-1β, iNOS, Arg1, CD206, and CD86, wherein IL-1β, iNOS, and CD86 are M1-type macrophage surface markers, and Agr1, CD206 is a surface marker of M2 macrophages. The primer sequences designed to amplify the genes are shown in Table 1 below.
[0046] Table 1 Sequences of amplification primer pairs
[0047] Primer name Forward primer (5'->3') Reverse primer (5'->3') CD11b ACTTGCAGTGAGAACACGTATG TCATCCGCCGAAAGTCATGTG IL-1β ATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA iNOS TTCAGTATCACAACCTCAGCAAG TGGACCTGCAAGTTAAAATCCC CD206 GCCGGTGACCTCACAAGTAT ACGAAGCCATTTGGTAAACG Agr1 GTGGAAACTTGCATGGACAAC AATCCTGGCACATCGGGAATC CD86 CTGCTCATCTATACACGGTTACC GGAAACGTCGTACAGTTCTGTG GAPDH GTAAGAAACCCTGGACCACCC AGGGAGATGCTCAGTGTTGG
[0048] Existing methods to polarize macrophages into the M1 type mainly use IFN-γ and LPS, but there are different opinions on the amount of LPS and the induction time. The effective concentration range of LPS screened out in the early stage of the present invention is 10-500 ng/mL. On this basis, different LPS dosages and induction times are further systematically compared to verify the optimal M1 cell polarization scheme.
[0049] First, different concentration gradients of LPS (10, 50, 100, 200, 500 ng/mL) and 20 ng/mL IFN-γ were used as treatment groups, respectively, and induced for 24 h. Untreated macrophages were used as controls, and PCR detection Expression of M1 macrophage polarization markers.
[0050] The results of M1 type polarization are as follows Figure 4 As shown, compared with the control group, the expressions of CD86, IL-1β and iNOS-1 in each treatment group were all increased, indicating that the cells were polarized to the M1 type ( Figure 4 A). Especially when the concentration of LPS is greater than 50 ng/mL, the expression of IL-1β and iNOS-1 in cells increases more significantly, and the characteristics of M1 type of cells are more obvious; when the concentration of LPS continues to increase, the expression of CD86, IL-1β and iNOS-1 in cells increases significantly. Expression tends to balance.
[0051] In a further example, to explore the time required for cells to polarize to the M1 type, 50 ng/mL or 100 ng/mL of LPS and 20 ng/mL IFN-γ were used as treatment groups to induce 24, 48 , 72 h, the expression of macrophage polarization markers was detected. The result is as Figure 4 B and Figure 4 As shown in C, it can be seen that when the concentration of LPS is 50 ng/mL, the expression of some polarization markers (IL-1β, iNOS-1) of the cells tends to balance at 48 h, while when the concentration of LPS is 100 ng/mL, The expressions of the polarization markers of the cells all tended to balance within 24 h. Finally, the cell viability of each treatment group was detected at different times, and the results were as follows: Figure 4 D shows. The experimental results showed that when the LPS concentration was 100 ng/mL, the cell viability was greater than 90% within 72 h. It can be seen that 100 ng/mL LPS had no significant effect on the cell viability. When the LPS concentration was further increased (200 ng/mL ), the cell viability gradually decreased with the prolongation of culture time. Based on the above comparative studies on the expression of polarization markers, different culture times, and cell viability, it was proved that co-induction of 100 ng/mL LPS and 20 ng/mL IFN-γ for 24 h is the optimal solution for the polarization of macrophages into M1 type .
[0052] Existing methods to polarize macrophages into the M2 type mainly use IL-13 or IL-10 to co-induce with IL-4, but the concentration and induction time of each factor are different. The present invention systematically compares different cytokine combinations, dosages and induction times, and screens the optimal M2 cell polarization scheme. The results are shown in Figure 5. Depend on Figure 5A It can be seen that under the same total concentration, the expression of cell polarization markers induced by the combination of cytokines is higher than that of cytokines alone, suggesting that the induction effect of the combination of cytokines is ideal. Among them, IL-4 and IL-13 The combination of , IL-4 and IL-10 had the best induction effect; the expression of cell polarization markers increased significantly with the increase of the total concentration of cytokines, and the expression of cell polarization markers tended to approach when the concentration reached 40 ng/mL. Balance, suggesting that 40 ng/mL is the ideal concentration of cytokines. Compare Figure 5 In B, the expression of cell polarization markers in each group at different induction times, it can be seen that the use of IL-10 or a combination containing IL-10 can make the cells reach the polarization peak at about 24 h, in which IL-4 and IL- The induction effect of the 10 combination is the most ideal; while the other IL-4 and IL-13 groups require a longer induction time. After screening, it was found that IL-4 and IL-10 (each 20 ng/mL, total concentration 40 ng/mL) induced for 24 h was an efficient M2 macrophage induction scheme.
[0053] The optimal M2 macrophage polarization scheme screened above was verified: several reported schemes were compared with the optimal scheme of the present invention, and the results are shown in Image 6 A- Image 6 d. Depend on Image 6 A- Image 6 C shows that compared with the control group, the expressions of CD206 and Arg-1 in each treatment group increase, indicating that the cells are polarized to the M2 type. At 24 h, the combination of 20 ng/mL IL-4 and 20 ng/mL IL-10 had the most obvious polarization effect on the cells. Polarization gradually increased, eventually approaching the combination of 20 ng/mL IL-4 and 20 ng/mL IL-10. The cell survival rate of each scheme was detected by MTT method, and it can be seen that the combinations of cytokines that induce macrophages to polarize to the M2 type have little effect on the cell survival rate within 72 h ( Image 6 D). Based on the above results, the present invention proves that the combined induction of 20 ng/mL IL-4 and 20 ng/mL IL-10 for 24 hours is the optimal solution for the M2 polarization of macrophages.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

no PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Similar technology patents

Anoectochilus formosanus polyploid induction method

ActiveCN112493123AImprove induction efficiencyImprove the phenomenon of low survival ratePlant tissue cultureHorticulture methodsScreening culturesMolecular biology
Owner:FUJIAN AGRI & FORESTRY UNIV

Inhibitor for inducing pluripotent stem cells, and inducing method and application thereof

ActiveCN102888401AImprove induction efficiencyGood structural stability and ability to cross cell membranesGenetic material ingredientsMammal material medical ingredientsDrugCarcinogenesis
Owner:INST OF ZOOLOGY CHINESE ACAD OF SCI

Culture medium for agriophyllum squarrosum tissue culture, adventitious bud induction method and adventitious root induction method

ActiveCN112042538AImprove induction efficiencyHigh induction rateHorticulture methodsPlant tissue cultureCulture mediumsAgriophyllum squarrosum
Owner:NORTHWEST INST OF ECO-ENVIRONMENT & RESOURCES CAS

Fire safety early warning device

PendingCN114754449AImprove induction efficiencyReduce smoke densityMechanical apparatusLighting and heating apparatusFire safetyEnvironmental geology
Owner:武汉尚燃科技有限公司

Classification and recommendation of technical efficacy words

  • Improve induction efficiency
  • Improve stability

Rotary ultrasonic head based on machine tool attachment

ActiveCN102151867AGood versatility and interchangeabilityImprove induction efficiencyTool holdersUltrasonic machiningEnergy loss
Owner:TIANJIN UNIV

Flounder tetraplont fry batch induction method

InactiveCN101595849AImprove induction efficiencyPloidy neatMicrobiological testing/measurementClimate change adaptationPloidyAgricultural science
Owner:YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI

In vitro induction amplification, freeze preservation and anabiosis method of immune cells

ActiveCN106701681AImprove induction efficiencyFast amplificationCulture processDead animal preservationCD16Antibody
Owner:成都安缇赛尔生物科技有限公司

Spathiphyllum somatic embryo inducing and plant regenerating method

InactiveCN102388805AImprove induction efficiencyEasy to getPlant tissue cultureHorticulture methodsCulture mediumsSomatic embryogenesis
Owner:广东省农业科学院花卉研究所

Surgical ligature clip

InactiveUS20080312670A1Improve stabilityAvoid spaceWound clampsOrthodontic ligatureArm moving
Owner:AESCULAP AG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products