In-vitro culture method for efficiently inducing polarization of macrophages

A technology of in vitro culture of macrophages, applied in the field of biomedicine, can solve the problems of lack of systematic research and insufficient elaboration, and achieve the effect of high stability and high induction efficiency

Pending Publication Date: 2022-01-28
NANTONG UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, the model of PMA-induced THP-1 monocyte differentiation into macrophages is widely used, but the concentration and time of PMA, the combination of cytokines that induce polarization, the concentration and time, these factors have a great impact on the final cell quality

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • In-vitro culture method for efficiently inducing polarization of macrophages
  • In-vitro culture method for efficiently inducing polarization of macrophages
  • In-vitro culture method for efficiently inducing polarization of macrophages

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0031] Example 1

[0032] THP-1 is a monocytic leukemia cell, and monocyte-derived macrophages highly express CD11b, and THP-1 cells undergo significant changes in morphology after being induced to differentiate into macrophages, from nearly round suspension cells to Multi-projectile adherent cells.

[0033] The present invention uses a real-time quantitative gene amplification fluorescence detection system (q-PCR) to detect the expression of CD11b in cells and analyze the morphology of cells to identify the situation in which THP-1 cells are induced to differentiate into macrophages.

[0034] Firstly, verify the most appropriate dosage of PMA: set up PMA treatment groups with different concentration gradients, blank (PMA concentration 0) as negative control, q-PCR to detect the expression of CD11b in cells, the primer sequences used are shown in Table 1; MTT method is also used for detection cell viability.

[0035] The results of this experiment see figure 2 A and figu...

Example Embodiment

[0037] Example 2

[0038] On the basis of the experiment in Example 1, to verify the effect of GM-CSF on THP-1-induced differentiation into macrophages, in the case of adding a certain concentration of PMA and inducing for 24 h, at the same time set the group of adding different concentration gradients of GM-CSF, Detect the expression of CD11b and the survival rate of cells, see the results figure 2 C and figure 2 d. from figure 2 C and figure 2 In D, it can be seen that when the concentration of GM-CSF is higher than 5 ng / mL, the expression of CD11b in cells increases significantly, far exceeding the induction effect of PMA alone. With the further increase of GM-CSF concentration, the cell viability gradually decreases .

[0039] Therefore, it is inferred that 100 ng / mL PMA and 10 ng / mL GM-CSF co-induced the degree of differentiation and cell activity of macrophages obtained by co-induction for 24 h is more suitable, which can be used as the culture conditions for TH...

Example Embodiment

[0043] Example 3

[0044] The present invention designs a method for detecting changes in the level expression of macrophage marker genes by q-PCR to identify macrophage polarization models.

[0045] The present invention screens out 5 genes that are closely related to macrophage polarization: IL-1β, iNOS, Arg1, CD206, and CD86, wherein IL-1β, iNOS, and CD86 are M1-type macrophage surface markers, and Agr1, CD206 is a surface marker of M2 macrophages. The primer sequences designed to amplify the genes are shown in Table 1 below.

[0046] Table 1 Sequences of amplification primer pairs

[0047] Primer name Forward primer (5'->3') Reverse primer (5'->3') CD11b ACTTGCAGTGAGAACACGTATG TCATCCGCCGAAAGTCATGTG IL-1β ATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA iNOS TTCAGTATCACAACCTCAGCAAG TGGACCTGCAAGTTAAAATCCC CD206 GCCGGTGACCTCACAAGTAT ACGAAGCCATTTGGTAAACG Agr1 GTGGAAACTTGCATGGACAAC AATCCTGGCACATCGGGAATC CD86 CTGCTC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an in-vitro culture method for efficiently inducing polarization of macrophages, wherein the method comprises the following steps: step 1, under a serum-free condition, stimulating THP-1 mononuclear cells with PMA and GM-CSF to differentiate the THP-1 mononuclear cells into macrophages; step 2, inducing the macrophages differentiated in the step 1 for 24 hours by using 20 ng/mL of IFN-gamma and 100 ng/mL of LPS to obtain M1 type macrophages; and step 3, inducing the macrophages differentiated in the step 1 for 24 hours by using 20 ng/mL of IL-4 and 20 ng/mL of IL-10 to obtain M2 type macrophages. According to the invention, an economic and perfect model in which a THP-1 mononuclear cell line is induced to differentiate into the macrophages and then polarized is adopted, and through detection of a plurality of markers (CD11b, CD86, CD206, iNOS, CD206, Agr-1 and IL-1beta), the macrophages induced to differentiate and polarized M1 and M2 type macrophages are identified.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to an in vitro culture method for efficiently inducing macrophage polarization and a marker for macrophage polarization analysis. Background technique [0002] Macrophages have a wide range of biological effects, such as anti-infection, anti-tumor, participation in immune response and immune regulation, etc. They are important immune cells that connect the natural immunity and specific immunity of the human body. It plays an important role in infectious and non-infectious diseases. It mainly phagocytizes and digests cell fragments and pathogens in a fixed or free form, activates lymphocytes or other immune cells, and makes them respond to pathogens. [0003] At present, there are three ways to obtain macrophages required for experiments: (1) directly obtain primary macrophages from animals or humans; (2) use colony-stimulating factors to induce primary monocytes to d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N5/0786C12Q1/6881G01N33/569
CPCC12N5/0645C12Q1/6881G01N33/56966C12N2501/22C12N2501/24C12N2501/052C12N2501/2304C12N2501/231C12N2501/727C12N2500/90C12N2501/999C12Q2600/158
Inventor 杨欢王国华王洲孙祥琳姜正林
Owner NANTONG UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap