Potato U6 RNA polymerase III type promoter and cloning and application thereof

A potato and promoter technology, applied in the field of genetic engineering, can solve the problems of limiting the application of potato gene editing technology, lack of potato U6 promoter and the like

Active Publication Date: 2022-02-01
YUNNAN AGRICULTURAL UNIVERSITY
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few studies on the endogenous U6 promoter that can be used for gene editing in potato, and there is still a lack of applicable potato U6 promoter, which limits the application of potato gene editing technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Potato U6 RNA polymerase III type promoter and cloning and application thereof
  • Potato U6 RNA polymerase III type promoter and cloning and application thereof
  • Potato U6 RNA polymerase III type promoter and cloning and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] The specific steps for obtaining two kinds of U6 gene promoters StU6 4-1 and StU6 8-1 in potato are as follows:

[0046] 1. Use Arabidopsis thaliana AtU6-1 gene sequence to perform BlastN comparison in the potato genome database (http: / / spuddb.uga.edu / dm_v6_1_download.sht-ml) to find out the typical U6 gene sequence in potato. There are only 3 SNP differences between the typical potato U6 gene sequence and the Arabidopsis AtU6-1 gene sequence, indicating that the U6 gene sequence is relatively conserved between potato and Arabidopsis. Both the potato U6 gene promoter sequence and the Arabidopsis AtU6-1 gene promoter sequence have two typical cis-acting elements, TATA box and USE motif. Finally, StU6 4-1 and StU6 8-1 promoters were selected for cloning.

[0047] 2. Design primers in the StU6 4-1 and StU6 8-1 promoter reference sequences for sequence cloning.

[0048] The following primers were designed for the StU6 4-1 promoter clone:

[0049] StU6 4-1pF: GGGCTTCACTGT...

Embodiment 2

[0056] The construction of potato StU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors, its specific steps are as follows:

[0057] 1. Using the 466 bp StU6 4-1 gene promoter fragment shown in SEQ ID No: 1 and the 511 bp StU6 8-1 gene promoter fragment shown in SEQ ID No: 2 as templates, design the following homology arms containing The primers were used for PCR amplification of the StU6 4-1 gene promoter and the StU6 8-1 gene promoter respectively:

[0058] StU6 4-1gF: GTGGAATCGGCAGCAAAGGAGGGCTTCACTGTGAATTTAG;

[0059] StU6 4-1gR: TGTTATTCTTCAGAGGTCTCTCAAACACATATGTTGTTGTTGA;

[0060] StU6 8-1gF: GTGGAATCGGCAGCAAAGGAAATTGACGGGTAGACATCA;

[0061] StU6 8-1gR: TGTTATTCTTCAGAGGTCTCTCAGACATAGGTTAATGTTTTG;

[0062] 2. Perform PCR amplification with high-fidelity enzyme PhantaR Max. The PCR reaction volume was 25 μL. The PCR reaction program was 95°C for 3 min; 30 cycles of 95°C for 30 s, 52°C for 30 s, 72°C for 30 s, and then 72°C for 5 min; the resulting PCR product w...

Embodiment 3

[0070] The specific steps for the construction of the NbPDS gene editing vector of Nicotiana benthamiana and the mutation of the NbPDS gene sequence are as follows:

[0071] 1. NbPDS gene editing target site design and target linker preparation

[0072] According to the NbPDS gene sequence of Nicotiana benthamiana, TACGAGAACTGCAGTCCACG was selected as the target site sequence, and the target linker primer pair was designed according to the sequence:

[0073] The following primer pairs were designed for the target linked to the StU6 4-1 promoter:

[0074] NbPDS-4-F: TTTGTACGAGAACTGCAGTCCACG;

[0075] NbPDS-4-R: AAACCGTGGACTGCAGTTCTCGTA;

[0076] Design the following primer pairs for the target linked to the StU6 8-1 promoter:

[0077] NbPDS-8-F: TCTGTACGAGAACTGCAGTCCACG;

[0078] NbPDS-8-R: AAACCGTGGACTGCAGTTCTCGTA;

[0079] Dissolve the above adapter primers into a 100 μM stock solution, add 1 μL of each paired primer to 98 μL 0.5×TE, mix and dilute to 1 μM. 90°C for 30 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering, particularly relates to a potato U6 RNA polymerase III type promoter, more particularly relates to StU64-1 and StU68-1 gene promoters, and further discloses a cloning method and application thereof. Two potato RNA polymerase III type promoters StU64-1 and StU68-1 are obtained by cloning in potatoes, have efficient transcriptional activity and can drive downstream sgRNA expression, and the activities of the two promoters and the feasibility of applying the promoters to potato CRISPR / Cas9 gene editing are respectively verified by virtue of an instantaneous transformation system of nicotiana benthamiana leaves and a stable transformation system of potatoes, and the CRISPR / Cas9 guided potato genome editing is realized. In the technical field of transgenosis, the promoters are not only suitable for potatoes, but also can be applied to other solanaceae crops such as tobacco.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, relates to the technical field of plant transgenics, and more specifically relates to the cloning and application of a potato U6 promoter. Background technique [0002] Potato (Solanum tuberosum) is the fourth largest food crop in the world, after rice, corn and wheat. Potato cultivars are mainly tetraploid (2n=4x=48), vegetatively propagated through tubers, are selfing crops, but have the characteristics of self-depression and self-incompatibility. Potato varieties are mainly selected through traditional cross breeding, that is, parents with better combining ability are used to prepare hybrid combinations, and the traits of the obtained seed progeny are identified, and then new varieties are selected. Therefore, the breeding cycle of new potato varieties is longer, and the breeding traits are more random, and it is difficult to take into account important traits such as yield, quali...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/11C12N15/82A01H5/00A01H6/82
CPCC12N9/1247C12N15/8218C12Y207/07006C12N2310/20
Inventor李有涵郭华春王琼马艳颖
OwnerYUNNAN AGRICULTURAL UNIVERSITY