Construction method and application of GLUD1 mutant gene knock-in mouse animal model

A technology of mutated genes and animal models, applied in the field of biomedicine, can solve problems such as undiscovered congenital hyperinsulinemia, and achieve good clinical application prospects, wide application value, and great social benefits

Pending Publication Date: 2022-03-29
NANJING SHENGDE INST OF BIOTECHNOLOGY CO LTD +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, studies on GLUD1 mutant knock-in mice and related hypoglycemia, hyperammonemia, and congenital hyperinsulinemia have not been found in the existing gene knock-in mouse bank

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of GLUD1 mutant gene knock-in mouse animal model
  • Construction method and application of GLUD1 mutant gene knock-in mouse animal model
  • Construction method and application of GLUD1 mutant gene knock-in mouse animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Cas9 / gRNA target design and in vitro Cas9 enzyme cleavage activity detection

[0053] (1) Experimental animals

[0054] 6-week-old healthy C57BL / 6 mice (weight 18±2g), 100 male and 100 each, provided by Shanghai Southern Model Biotechnology Co., Ltd. After two weeks of isolation and rearing, they can reach the age of 8 weeks required by the experiment ; 60 healthy B6D2F1 mice aged 6-8 weeks, half male and half female, weighing 24±2g, were purchased from Shanghai Southern Model Biotechnology Co., Ltd., and the mice were fed in an SPF-grade environment in strict accordance with the animal feeding environment The management regulations ensure that the daily temperature is 22°C, the humidity is 40% to 60%, and the light time and dark time in the animal room are half and half. All related operations and handling of animal experiments strictly follow the relevant management regulations on experimental animals.

[0055] (2) Experimental reagents

[0056] Cas9 Nuc...

Embodiment 2

[0069] Embodiment 2 Construction of Donor vector

[0070] The homologous recombination vector (Donor vector) was constructed by the method of In-Fusing cloning. Wherein, the base sequence information of the constructed Donor vector is shown in SEQ ID NO:2.

[0071] SEQ ID NO: 2

[0072]GATTTGCCCCGCGCCTCTTCGGCTTCGGCGCGGCGTCACTCTCCGGCCGGCCGCGCAGCGGATCCGCACACCGTTCCGGCCCAAGGCGGAAAGGAGGGGCCTGGTGACTCATGCGGCCGGGGCTGCTGGCCAGCCAGCGAGGCCTCCCTGCAGTCCGCTTCCACCTCCCAGGCCGCCGCGCGTGCACACGGGACCGACCTTCCGGGCCGCGGCCGCGTCCGACCGCTCTCAGGAGCCCAGGCCTCCGGGCCGCAGCCCGCGCGCGTCCACGCTAGCCCCGCCCCCGCCCGCGAGCATGCGCACCAAGCCCATCTGCAAAGGCGCGCCCCCCGCCGCCGCAGCCGCACGCGCCGCCGCCTGGAGGCCGGGCAAGGCCGCGGCGGAGGCGAGGCCCAGCGCCCTGGGCGGCGCGCGGCCGCCGAAGTCCGTCCTCCCGGTGGGGCGACAAGCGGCGCAGGGGAGGGGACAGCCAGACAAGCAGGAAGCCGCGGCTTAAAAGGGCAGCTCGCGCCCAGCCCTTCCTCCCCGCGGTCCAGGCCTGCGAGCTCCGGTCTTTACAGCTCCCGCCGCACTCGCCTCAGCCCGCCGCCGCCGCCATGTACCGCTACCTGGGCGAAGCGCTGTTGCTGTCCCGGGCCGGGCCCGCTGCCCTGGGCTCGGCGTCCGCCGACTCGGCCGCGTTGCTGGGCTGGGCCCGGGGAC...

Embodiment 3

[0073] Example 3 Microinjection

[0074] (1) Component preparation: The microinjection components were prepared according to Table 3, and the prepared components were subjected to high-speed centrifugation at 4°C, and 15 μL was taken out after 10 min for subsequent microinjection experiments.

[0075] Table 3 Concentration and consumption of each component of microinjection

[0076] components concentration Dosage Cas9 mRNA 200ng / μl 5μl Donor vector 200ng / μl 5μl sgRNA 200ng / μl 5μl Add RNase-free H 2 O to

40μl 25μl

[0077] (2) Ovulation treatment of embryo donor mice

[0078] Prepare 8-week-old and healthy C57BL / 6J female mice, hormones pregnant horse serum gonadotropin (PMSG) and human chorionic gonadotropin (HCG). PMSG was injected at 14:30 in the afternoon, and the concentration of PMSG injected into each female mouse was 10 units (10 IU / mL), and the dose was 0.2 ml. After 46-48 hours, HCG was injected again. Th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of a GLUD1 mutant gene knock-in mouse animal model, which comprises the following steps: (1) determining a specific target site of a GLUD1 mutant gene, and obtaining Cas9 mRNA and sgRNA in an in-vitro transcription mode; (2) constructing a homologous recombinant vector (Donor vector); and (3) uniformly mixing Cas9 mRNA, Donor vector and sgRNA with qualified in-vitro activity, micro-injecting the mixture into a fertilized egg of a donor mouse, transplanting the fertilized egg into a receptor mouse, inoculating, and breeding offspring. The homozygous mouse animal model can be obtained through the construction method, and an effective experimental animal model is provided for research of hypoglycemia, hyperammonemia and congenital hyperinsulinemia, drug research and development and drug efficacy evaluation. The construction method of the GLUD1 mutant gene knock-in mouse animal model is provided for the first time, and the construction method has great application value in preparation of drugs for detecting / treating hyperammonemia accompanied by congenital hyperinsulinemia and has great social benefits.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a construction method and application of a GLUD1 mutant gene knock-in mouse animal model. Background technique [0002] Congenital hyperinsulinemia (congenital hyperinsulinism, CHI) is mainly a disease caused by gene mutations encoding islet β-cell function, also known as persistent hyperinsulinemic hypoglycemia in infants. Congenital hyperinsulinemia is difficult to cure, and it is easy to cause hypoglycemia in young infants, which is characterized by persistent hypoglycemia and relative hyperinsulinemia disproportionate to blood sugar levels, accompanied by hypoketone body hypolipidemia, age The smaller the hypoglycemia, the greater the harm, especially the damage to brain function caused by hypoglycemia. Neonatal hypoglycemia is a serious disease that threatens the health and even life of newborns. Repeated episodes of severe hypoglycemia not only threaten lif...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/90C12N15/54A01K67/027C12Q1/6888C12Q1/6858A61K49/00
CPCC12N15/8509C12N15/907C12N9/0016A01K67/0278C12Q1/6888C12Q1/6858A61K49/0008C12Y104/01002C12Q2600/156C12Q2600/124A01K2207/15A01K2217/072A01K2227/105A01K2267/0362C12Q2531/113
Inventor李长红孟诗朱秋莎
OwnerNANJING SHENGDE INST OF BIOTECHNOLOGY CO LTD