Unlock instant, AI-driven research and patent intelligence for your innovation.

Antigen applicable to production of anti-cryptochrome 4 antibody

A cryptochrome and antigen technology, applied in the field of genetic engineering, can solve the problems of insufficient species versatility, difficulty in applying cryptochrome 4 protein detection, insufficient antigen specificity, etc.

Pending Publication Date: 2022-04-12
ACAD OF MILITARY SCI PLA CHINA ACAD OF MILITARY MEDICAL SCI INST OF MILITARY VETERINARY MEDICINE
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] One is the poor immunogenicity, which makes it difficult for the obtained antibodies to be applied to the detection of cryptochrome 4 protein by multiple methods;
[0006] The second is that the antigen specificity is insufficient, resulting in non-specific cross-immune reactions between the obtained antibodies and other proteins of the target animal;
[0007] The third is that the generality of the species is insufficient. This is because the short peptides derived from cryptochrome 4 of a single species are generally difficult to have high homology with cryptochrome 4 of other species, so the antibodies produced are difficult to broadly recognize multiple peptides. Cryptochrome 4 protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antigen applicable to production of anti-cryptochrome 4 antibody
  • Antigen applicable to production of anti-cryptochrome 4 antibody
  • Antigen applicable to production of anti-cryptochrome 4 antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] The construction of embodiment 1 antigen expression vector

[0031] After total RNA was extracted from pigeon midbrain tissue using Tiangen’s total RNA extraction kit, the first-strand cDNA was synthesized using Thermo’s Maxima H First Strain cDNA Synthesis Kit. Afterwards, the first-strand cDNA was used as a template, and the KAPA HiFi HotStart ReadyMix PCR Kit from Kapa Company was used to carry out the PCR process (Sense primer: CTTGGATCCAGCGCGTTTCTCCACCACTACACG; Antisense primer: AGCAAGCTTTTCCCTCCCCCCTGGCCACCTTTC), the PCR conditions were: 95°C for 3 min, (98°C for 20 s, 60°C 15s, 1min at 72°C) a total of 25 cycles, 1min at 72°C.

[0032] The PCR product was recovered using the NucleoSpin Gel and PCR Clean-up kit from MACHEREY-NAGEL. The purified DNA and pET21a vector were digested with BamHI and HindIII respectively, and then the two were gel recovered. After the purified product was ligated overnight at 16°C using T4 DNA ligase, the product was transformed into ...

Embodiment 2

[0033] Example 2 Expression and purification of Cry4-Ctem

[0034]Transform the expression vector into the BL21(DE3) strain, and inoculate a single clone into 5 mL of LB liquid medium added with ampicillin after coating, grow overnight at 220 rpm at 37°C, and inoculate them all into 1 L of liquid medium added with ampicillin. LB liquid medium. Keep the shaker at 37°C and 220rpm to make the bacteria grow rapidly. When the OD600 is in the range of 0.8-1.0, add IPTG with a final concentration of 1 mM to the culture medium, lower the temperature of the shaker to 22°C, and continue culturing for 16 hours, then centrifuge at 4000 rpm for 30 minutes to collect the bacteria. Add 30mL lysis buffer (50mM NaH2PO4, 200mM NaCl, 10mM imidazole, pH 8.0) to the cells, then add lysozyme at a final concentration of 0.2mg / mL and 0.1mM protease inhibitor AEBSF, and incubate on ice for 30min The bacteria were initially lysed. After that, ultrasonic crushing was carried out, and the ultrasonic w...

Embodiment 3

[0035] Example 3 Preparation of Anti-Cryptochrome4 polyclonal antibody

[0036] The purified antigen was dialyzed at 4°C to 0.01M, pH = 7.2 phosphate buffer, and the protein was used as the final antigen to subcutaneously immunize New Zealand big-eared white rabbits for a total of 5 times, with an interval of 2 weeks between each immunization . The first immunization was emulsified with complete Freund's adjuvant, the second to fifth immunization was boosted with incomplete Freund's adjuvant, and each immunization used 0.5 mg of antigen. One week after the fourth immunization, blood was collected for Elisa detection.

[0037] In Elisa detection, first use NaHCO 3 Dilute the antigen in the buffer solution to a concentration of 2 μg / ml, add 100 μl of the diluted antigen to each well of a 96-well plate, and coat at 4°C overnight; use 5% skimmed milk powder to block for 2 hours; press 1:2000, 1: 4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, 1:256000 for doubling dilution o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an antigen suitable for producing an anti-cryptochrome 4 antibody, which comprises an antigen core site Cry4-Ctem of pigeon cryptochrome 4 protein, the antigen core site Cry4-Ctem is located at 401-525 amino acids at the C terminal of the pigeon cryptochrome 4 protein, and the amino acid sequence of the antigen core site Cry4-Ctem is as shown in SEQ ID No.1. The antibody prepared from the antigen can specifically detect endogenous and exogenous expressed cryptochrome 4 protein by multiple methods (including Western Blot and immunofluorescence), and does not generate cross immune reaction with other proteins of corresponding species; in addition, the antigen used by the antibody is highly homologous with the multi-species cryptochrome 4, so that the multi-species cryptochrome 4 protein can be detected in a broad-spectrum manner.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to an antigen suitable for the production of anti-cryptochrome 4 antibody. Background technique [0002] Cryptochrome 4 (Cryptochrome4) is a newly discovered light-sensitive protein that exists in non-mammalian vertebrates, and has potential functions of light-induced rhythm regulation and light-induced magneto-sensitivity. Anti-Cryptochrome 4 (Anti-Cryptochrome 4) antibody is mainly used to detect Cryptochrome 4 protein by western blotting and immunofluorescence. [0003] Due to the late discovery of the Cryptochrome 4 gene, there is no commercial anti-Cryptochrome 4 antibody on the market. In scientific research, the anti-cryptochrome 4 antibody mainly uses a short-chain polypeptide with a length of 15-25 amino acids as an antigen, and has been polyclonal in rabbits and mice (J.Biol.Chem., 2012, 287, 42634-42641.), monoclonal (Curr. Biol., 2018, 28, 211-223.e214.) pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/46C07K14/465C12N15/70G01N33/68
Inventor 王雪峰高玉伟王铁成赵玉东
Owner ACAD OF MILITARY SCI PLA CHINA ACAD OF MILITARY MEDICAL SCI INST OF MILITARY VETERINARY MEDICINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More