(S)-transaminase and application thereof

A transaminase and amino technology, which is applied in the field of preparing L-glufosinate-ammonium by biological multi-enzyme coupling method, can solve the problems of difficulty in product separation and purification, difficulty in increasing the amount of substrate input, etc.

Pending Publication Date: 2022-06-24
YONGNONG BIOSCI +2
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this process realizes the dynamic kinetic resolution of glufosinate-ammonium racemate, there are obvious defects in this process: first, it is difficult to increase the substrate dosage (only 300mM D, L-glufosinate); The reaction of PPO to L-glufosinate-ammonium guided by the above-mentioned method can only achieve a conversion rate of 90% due to the influence of reversible reactions; the third is that because the amine donor is L-glutamic acid, there is still a large amount of residue after the reaction, and the product is separated and purified difficulty

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • (S)-transaminase and application thereof
  • (S)-transaminase and application thereof
  • (S)-transaminase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1: Cultivation of engineered bacteria cells

[0050] The engineered bacteria E.coli BL21(DE3) / pCDFduet-1-APH1, E.coli BL21(DE3) / pCDFduet-1-EN5, E.coli BL21(DE3) / pCDFduet-1-APH1-EN5 were streaked on a plate After activation, single colonies were inoculated into 10 mL of LB liquid medium containing 50 μg / mL kanamycin, and incubated at 37°C with shaking for 10 h. Transfer to 50 mL of LB liquid medium containing 50 μg / mL kanamycin at 2% of the inoculum, and shake at 37 °C until the OD600 reaches about 0.8, add IPTG with a final concentration of 0.5 mM, and shake at 28 °C Incubate for 12h. After the cultivation, the culture solution was centrifuged at 8000 rpm for 10 min, the supernatant was discarded, the cells were collected, and stored in a -80°C ultra-low temperature refrigerator until use.

Embodiment 2

[0051] Example 2: Enzyme sequence synthesis and strain construction

[0052] The sequence derived from Pseudarthrobacter chlorophenolicus annotated as (R)-transaminase (APH1) (the amino acid sequence is shown in SEQ ID NO. The plasmid pET-28a(+) was expressed to give pET28a-APH1. After sequencing and verification, the pET28a-APH1 was transferred into the expression host E. coli BL21 (DE3) for subsequent expression of the recombinase.

[0053] The sequence derived from Corynebacterium vitaeruminis DSM 20294 annotated as (S)-transaminase (EN5) (the amino acid sequence is shown in SEQ ID NO.3, the nucleotide sequence is shown in SEQ ID NO.4) was subjected to full gene synthesis, Insert into expression plasmid pET-28a(+) to obtain pET28a-EN5. After sequencing and verification, the pET28a-EN3 was transferred into the expression host E. coli BL21 (DE3) for subsequent expression of the recombinase.

Embodiment 3

[0054] Example 3: Construction of co-expression strains containing (R)-transaminase and (S)-transaminase systems:

[0055] The APH1 gene used in Example 2 was connected to the multi-cloning site vector pCDFduet-1 by a one-step cloning kit, the restriction sites were HindIII and XhoI, and the one-step cloning primers were C1-F and C1-R (Table 1) , the plasmid pCDFduet-1-APH1 was constructed. On the basis of the pCDFduet-1-APH1 plasmid, the EN5 used in Example 2 was connected to the second cloning site of the multi-cloning site vector pCDFduet-1 by a one-step cloning kit, and the restriction sites were NdeI and XhoI, the one-step cloning primers were C2-F and C2-R, the plasmid pCDFduet-1-APH1-EN5 was constructed, and the co-expression strain E.coli BL21(DE3) / pCDFduet-1-APH1-EN5 was constructed. APH1-EN5 constructs such as figure 2 shown.

[0056] Table 1: Cloning primer sequences

[0057] primer sequence C1-F CCCAAGCTTAAGGAGATATACATATGACCTCTCCCGCTTCCGT ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for preparing L-glufosinate-ammonium by using a biological multienzyme coupling method, which comprises the following step of: converting D, L-glufosinate-ammonium into L-glufosinate-ammonium in the presence of (R)-transaminase, (S)-transaminase, an amino receptor and an amino donor. According to the method disclosed by the invention, the L-glufosinate-ammonium can be prepared by efficiently splitting the high-concentration D, L-glufosinate-ammonium.

Description

[0001] This application is a divisional application of a Chinese patent application submitted on December 17, 2020, with the application number of 202011496575.9 and the invention titled "Method for preparing L-glufosinate by biological multi-enzyme coupling method". technical field [0002] The present application relates to the field of biotechnology, and in particular to a method for preparing L-glufosinate-ammonium using a biological multi-enzyme coupling method. Background technique [0003] Glufosinate-ammonium (also known as bialaphos, glufosinate, the trade names include Baoshida, Besutun, etc., the English name is phosphinothricin (abbreviated as PPT), the chemical name is 2-amino-4-[hydroxy (methyl) ) phosphono]butyric acid), is the world's second largest genetically modified crop tolerant herbicide, developed and produced by Hearst Company. Glufosinate-ammonium is a phosphonic acid herbicide, a glutamine synthase inhibitor, a non-selective (killing) contact herbic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12N1/21C12P13/04C12R1/19
CPCC12P13/04C12N9/1096C12N15/70C12Y206/01
Inventor王华磊魏东芝吴承骏刘清海罗中华张长雷
OwnerYONGNONG BIOSCI