Optimized Cas protein and application thereof
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0243] Example 1. Acquisition of Cas muteins
[0244] For a known Cas protein (Cas12f.4 in CN111757889B, in this example, it is called Cas12i3), the applicant predicted key amino acid sites that may affect its biological function through bioinformatics, and put the amino acid position Points were mutated to obtain a Cas mutant protein with enhanced editing activity. Specifically, the coding sequence of Cas12i3 was codon-optimized (human) and synthesized. The amino acid sequence of wild-type Cas12i3 is shown in SEQ ID No.1, and its nucleic acid sequence is shown in SEQ ID No.2. Site-directed mutagenesis of the amino acids where the potential Cas12i3 binds to the target sequence.
[0245] Variants of Cas proteins were generated by PCR-based site-directed mutagenesis. The specific method is to divide the DNA sequence design of Cas12i3 protein into two parts centered on the mutation site, design two pairs of primers to amplify the two parts of the DNA sequence respectively, and ...
Embodiment 2
[0248] Example 2. Verification of the editing activity of Cas muteins
[0249]The different Cas proteins obtained in Example 1 were used to verify their gene editing activity in animal cells, and the target for FUT8 gene design in Chinese hamster ovary cells (CHO), FUT8-Cas-XX-g3: TTC CAGCCAAGGTTGTGGACGGATCA , the italicized part is the PAM sequence, and the underlined area is the targeting region. The vector pcDNA3.3 was transformed with EGFP fluorescent protein and PuroR resistance gene. The SV40 NLS-Cas-XX fusion protein was inserted through the restriction site XbaI and PstI; the U6 promoter and gRNA sequence were inserted through the restriction site Mfe1. The CMV promoter promotes the expression of the fusion protein SV40NLS-Cas-XX-NLS-GFP. The protein Cas-XX-NLS and the protein GFP were linked with the linker peptide T2A. The promoter EF-1α promotes the expression of the puromycin resistance gene. Plating: CHO cells are plated to 70-80% confluence, and the number...
Embodiment 3
[0253] Example 3. Validation of the editing activity of mutant Cas protein S7R at other multiple sites
[0254] In this embodiment, the editing activity of other multiple sites is verified for the site S7R that can improve the editing efficiency of Cas protein verified in Example 2; the editing efficiency is verified in the same manner as Example 2.
[0255] like figure 2 As shown, the results showed that the editing efficiency of the S7R mutant Cas protein was significantly improved compared with the wild-type Cas protein. Types of targeted gene editing include base deletion, base insertion, and base substitution.
[0256] The targets tested include the following 4 targets:
[0257] Target 1: FUT8-Cas-XX-sgRNA1: TTGACAAACTGGGATACCCACCACAC
[0258] Target 2: FUT8-Cas-XX-sgRNA6: TTGAAGCCAAGCTTCTTGGTGGTTTC
[0259] Target 3: FUT8-Cas-XX-sgRNA11: TTGCCTCCTTTAACAAAGAAGGGTCA
[0260] Target 4: FUT8-Cas-XX-sgRNA13: TTGTTAAAGGAGGCAAAGACAAAGTA
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


