Unlock instant, AI-driven research and patent intelligence for your innovation.

Optimized Cas protein and application thereof

Active Publication Date: 2022-06-28
舜丰生物科技(海南)有限公司 +1
View PDF8 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the PAM sequences of Cas9, Cpf1, CasX, and CasY are relatively complex and diverse, while C2c1 recognizes a strict 5'-TTN, so its target site is easier to predict than other systems, thereby reducing potential off-target effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Optimized Cas protein and application thereof
  • Optimized Cas protein and application thereof
  • Optimized Cas protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0243] Example 1. Acquisition of Cas muteins

[0244] For a known Cas protein (Cas12f.4 in CN111757889B, in this example, it is called Cas12i3), the applicant predicted key amino acid sites that may affect its biological function through bioinformatics, and put the amino acid position Points were mutated to obtain a Cas mutant protein with enhanced editing activity. Specifically, the coding sequence of Cas12i3 was codon-optimized (human) and synthesized. The amino acid sequence of wild-type Cas12i3 is shown in SEQ ID No.1, and its nucleic acid sequence is shown in SEQ ID No.2. Site-directed mutagenesis of the amino acids where the potential Cas12i3 binds to the target sequence.

[0245] Variants of Cas proteins were generated by PCR-based site-directed mutagenesis. The specific method is to divide the DNA sequence design of Cas12i3 protein into two parts centered on the mutation site, design two pairs of primers to amplify the two parts of the DNA sequence respectively, and ...

Embodiment 2

[0248] Example 2. Verification of the editing activity of Cas muteins

[0249]The different Cas proteins obtained in Example 1 were used to verify their gene editing activity in animal cells, and the target for FUT8 gene design in Chinese hamster ovary cells (CHO), FUT8-Cas-XX-g3: TTC CAGCCAAGGTTGTGGACGGATCA , the italicized part is the PAM sequence, and the underlined area is the targeting region. The vector pcDNA3.3 was transformed with EGFP fluorescent protein and PuroR resistance gene. The SV40 NLS-Cas-XX fusion protein was inserted through the restriction site XbaI and PstI; the U6 promoter and gRNA sequence were inserted through the restriction site Mfe1. The CMV promoter promotes the expression of the fusion protein SV40NLS-Cas-XX-NLS-GFP. The protein Cas-XX-NLS and the protein GFP were linked with the linker peptide T2A. The promoter EF-1α promotes the expression of the puromycin resistance gene. Plating: CHO cells are plated to 70-80% confluence, and the number...

Embodiment 3

[0253] Example 3. Validation of the editing activity of mutant Cas protein S7R at other multiple sites

[0254] In this embodiment, the editing activity of other multiple sites is verified for the site S7R that can improve the editing efficiency of Cas protein verified in Example 2; the editing efficiency is verified in the same manner as Example 2.

[0255] like figure 2 As shown, the results showed that the editing efficiency of the S7R mutant Cas protein was significantly improved compared with the wild-type Cas protein. Types of targeted gene editing include base deletion, base insertion, and base substitution.

[0256] The targets tested include the following 4 targets:

[0257] Target 1: FUT8-Cas-XX-sgRNA1: TTGACAAACTGGGATACCCACCACAC

[0258] Target 2: FUT8-Cas-XX-sgRNA6: TTGAAGCCAAGCTTCTTGGTGGTTTC

[0259] Target 3: FUT8-Cas-XX-sgRNA11: TTGCCTCCTTTAACAAAGAAGGGTCA

[0260] Target 4: FUT8-Cas-XX-sgRNA13: TTGTTAAAGGAGGCAAAGACAAAGTA

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of nucleic acid editing, and particularly relates to the technical field of regularly clustered interval short palindromic repeat (CRISPR). Specifically, the invention provides an optimized Cas protein and application thereof, and the optimized Cas protein has a wide application prospect.

Description

technical field [0001] The present invention relates to the field of gene editing, in particular to the technical field of regularly clustered interspaced short palindromic repeats (CRISPR). Specifically, the present invention relates to an optimized Cas protein and its application, in particular to a Cas protein with improved activity and its application. Background technique [0002] CRISPR / Cas technology is a widely used gene editing technology. It specifically binds target sequences on the genome through RNA guidance and cleaves DNA to generate double-strand breaks, and uses biological non-homologous end joining or homologous recombination for site-specific gene editing. [0003] The CRISPR / Cas9 system is the most commonly used type II CRISPR system, which recognizes the PAM motif of 3'-NGG and blunt-ends the target sequence. CRISPR / Cas Type V system is a newly discovered CRISPR system, which has a 5'-TTN motif and performs sticky end cleavage of target sequences, such...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/22C12N15/55C12N15/113C12Q1/6816A61K31/7088A61P43/00
CPCC12N9/22C12N15/113C12Q1/6816A61K31/7088A61P43/00C12N2310/20C12N2800/22C12Q2521/327C12Q2565/519C12Q2563/107
Inventor 段志强
Owner 舜丰生物科技(海南)有限公司