HER2/CEP17 gene detection probe and application thereof
A detection probe and gene detection technology, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems that the labeling effect needs to be further improved, and achieve the effect of sensitive detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] The preparation method of the HER2 detection probe includes the following steps:
[0034] Pick a clone that contains the HER2 gene sequence of the target gene, such as figure 1 As shown in the table below, it was purchased from Invitrogen RP11BAC and CTD BAC clone library.
[0035] BAC Insert start and end positions size (bp) CTD-2019C10 chr17:39577926-39786803 208878 RP11-1044P23 chr17:39715531-39910359 194829 RP11-94L15 chr17:39655584-39817309 161726 RP11-62N23 chr17:39569388-39726617 157230
[0036] Probe preparation: Use OMEGA's BAC / PAC DNA mass extraction kit to extract ultra-low copy plasmid DNA from different BAC clones according to the operation method required by the instructions, and quantify the plasmid DNA by measuring the absorbance of A260 and A280. If the concentration is more than 200ng / μl, one, two or three mixed plasmids of HER2 gene are obtained.
[0037] Each clone was labeled and verified with peri...
Embodiment 2
[0052] The preparation method of CEP17 detection probe comprises the following steps:
[0053] (1) Find the specific sequence of CEP17, and design primers according to the high specificity fragment obtained by screening, and construct a plasmid pUc-CEP17 containing this fragment.
[0054] Design primer sequences: probe primer 1, tggatggagcaggtttgagaca
[0055] Probe primer 2, tcgttttccaccacaggcct
[0056] (2) pUc-CEP17 plasmid extraction, using omega kit for extraction.
[0057] (3) The probe labeling method is PCR labeling
[0058] The unlabeled PCR system is as follows
[0059] ingredients Dosage 2× marker-specific PCR Mix 25μl dNTPs, 2mM each 5μl Probe Primer 1 (10pmol / μL) 1μL (10μM) Probe Primer 2 (10pmol / μL) 1μL (10μM) template DNA 1ng plasmid DNA Ultra-pure water Make up to 50 μL
[0060] Reaction conditions:
[0061]
[0062] Agarose electrophoresis: brighter bands between 500-700bp
[0063] (5) Glue rec...
Embodiment 3
[0073] The preparation method of HER2 / CEP17 probe mixture comprises the following steps:
[0074]
[0075]
[0076] After mixing, add (V / 10) 3M sodium acetate (pH5.2) and (2.5V) absolute ethanol (-20°C pre-cooling) to mix, precipitate at -20°C overnight, centrifuge at 14000g for 15min at 4°C, wash with 70% ethanol, 50 μL probe hybridization solution (including dextran sulfate, deionized formamide, 2×SSC) was dissolved.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


