Unlock instant, AI-driven research and patent intelligence for your innovation.

HER2/CEP17 gene detection probe and application thereof

A detection probe and gene detection technology, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems that the labeling effect needs to be further improved, and achieve the effect of sensitive detection

Pending Publication Date: 2022-07-05
ZHENGZHOU KODIA BIOTECHNOLOGY CO LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Clinical use of probes approved by the US FDA to detect HER2, but its labeling effect still needs to be further improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HER2/CEP17 gene detection probe and application thereof
  • HER2/CEP17 gene detection probe and application thereof
  • HER2/CEP17 gene detection probe and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The preparation method of the HER2 detection probe includes the following steps:

[0034] Pick a clone that contains the HER2 gene sequence of the target gene, such as figure 1 As shown in the table below, it was purchased from Invitrogen RP11BAC and CTD BAC clone library.

[0035] BAC Insert start and end positions size (bp) CTD-2019C10 chr17:39577926-39786803 208878 RP11-1044P23 chr17:39715531-39910359 194829 RP11-94L15 chr17:39655584-39817309 161726 RP11-62N23 chr17:39569388-39726617 157230

[0036] Probe preparation: Use OMEGA's BAC / PAC DNA mass extraction kit to extract ultra-low copy plasmid DNA from different BAC clones according to the operation method required by the instructions, and quantify the plasmid DNA by measuring the absorbance of A260 and A280. If the concentration is more than 200ng / μl, one, two or three mixed plasmids of HER2 gene are obtained.

[0037] Each clone was labeled and verified with peri...

Embodiment 2

[0052] The preparation method of CEP17 detection probe comprises the following steps:

[0053] (1) Find the specific sequence of CEP17, and design primers according to the high specificity fragment obtained by screening, and construct a plasmid pUc-CEP17 containing this fragment.

[0054] Design primer sequences: probe primer 1, tggatggagcaggtttgagaca

[0055] Probe primer 2, tcgttttccaccacaggcct

[0056] (2) pUc-CEP17 plasmid extraction, using omega kit for extraction.

[0057] (3) The probe labeling method is PCR labeling

[0058] The unlabeled PCR system is as follows

[0059] ingredients Dosage 2× marker-specific PCR Mix 25μl dNTPs, 2mM each 5μl Probe Primer 1 (10pmol / μL) 1μL (10μM) Probe Primer 2 (10pmol / μL) 1μL (10μM) template DNA 1ng plasmid DNA Ultra-pure water Make up to 50 μL

[0060] Reaction conditions:

[0061]

[0062] Agarose electrophoresis: brighter bands between 500-700bp

[0063] (5) Glue rec...

Embodiment 3

[0073] The preparation method of HER2 / CEP17 probe mixture comprises the following steps:

[0074]

[0075]

[0076] After mixing, add (V / 10) 3M sodium acetate (pH5.2) and (2.5V) absolute ethanol (-20°C pre-cooling) to mix, precipitate at -20°C overnight, centrifuge at 14000g for 15min at 4°C, wash with 70% ethanol, 50 μL probe hybridization solution (including dextran sulfate, deionized formamide, 2×SSC) was dissolved.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene detection, in particular to an HER2 / CEP17 gene detection probe and application thereof. According to the invention, a plurality of nucleic acid fragments are screened to obtain a probe with an optimal marking effect. The probe provided by the invention is used for detecting a sample based on the FISH technology, and can obtain a more accurate and more sensitive detection effect by taking the probe as a reagent for breast cancer diagnosis.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a HER2 / CEP17 gene detection probe and its application. Background technique [0002] Breast cancer is a malignant tumor that occurs in the glandular epithelium of the breast, and is a cancer that develops from breast tissue. Studies have shown that human epidermal growth factor receptor 2 (HER2), a receptor-type tyrosine kinase, has gene amplification and protein overexpression in 20% to 30% of primary breast invasive ductal carcinomas . HER2-positive breast cancer is highly invasive, with short disease-free survival and poor prognosis. The "2005 St Gallen International Treatment Guidelines" pointed out that among the assessment factors of breast cancer risk level, although lymph node status is still the most important factor, HER2 status directly affects the level of risk. When lymph nodes are negative or only 1 to 3 lymph nodes have metastases, such as HER2 overexpres...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/6841C12N15/11
CPCC12Q1/6886C12Q1/6841C12Q2600/158C12Q2600/136C12Q2563/107
Inventor 刘一丁李先坤王艺杰
Owner ZHENGZHOU KODIA BIOTECHNOLOGY CO LTD