Method for obtaining CLas infected diaphorina citri polypide
A technology of citrus psyllids and worms, which is applied in the field of insect physiology and biochemistry, can solve the problems that plague the citrus industry and the difficulty in the prevention and control of Huanglongbing, and achieve the effect of reducing costs and reducing time costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Cultivation of isolated citrus shoots:
[0045] The isolated plants were raised with Hoagland nutrient solution of different dilution ratios, and the survival status of the branches was observed. It includes the following steps:
[0046] The virus-free seedlings cultivated in the greenhouse were confirmed to be susceptible to the disease by inoculation with citrus huanglongbing, and the tender branches of the trees infected with citrus huanglongbing were collected. After PCR detection, the branches infected with huanglongbing were selected and divided into 4 groups. Three shoots were repeated, and were cultured in tap water, 0.1× Hoagland nutrient solution, 0.5× Hoagland nutrient solution, 1× Hoagland nutrient solution and 2× Hoagland nutrient solution. Physiological state of isolated shoots. Finally, 0.5 × Hoagland nutrient solution was determined as the optimum nutrient solution concentration, see Table 1.
[0047] Among them, PCR detection primers are:
[0048] F...
Embodiment 2
[0054] Screening of susceptible citrus shoots:
[0055] Use the PCR detection technology in Example 1 to detect the DNA corresponding to the positive material and use ddH2 O was diluted to 150ng / μL for real-time PCR experiments.
[0056] Real-time fluorescent quantitative PCR primers are:
[0057] F: 5'TGGAGGTGTAAAAGTTGCCAAA3'
[0058] R: 5'CCAACGAAAAGATCAGATATTCCTCTA 3'
[0059] The reaction system is: ddH 2 O 3.5 μL; SYBR 5 μL; F / R 0.25 μL; cDNA template 1 μL; total system 10 μL.
[0060] The reaction program was: pre-denaturation at 95°C for 1 min; 45 cycles of 95°C for 15s, 59°C for 15s, and 72°C for 45s. All reactions were performed on a Roche LightCycler 480Ⅱ real-time fluorescence quantitative PCR instrument. After the reaction is complete, choose C t In vitro shoots with similar values were used for subsequent experiments.
[0061] according to figure 1 It can be seen from the results in Table 1 that branches 1-2, 4, 7-10 (Z1-Z2, Z4, Z7-Z10) are positive bran...
Embodiment 3
[0065] Experiments on bacteria acquisition of citrus psyllids in different insect stages:
[0066] The citrus psyllid adults, 4-5 instar nymphs, and 3 instar and below nymphs were subjected to bacteria acquisition experiments, and the most suitable bacteria acquisition period was screened, which specifically included the following steps:
[0067] The citrus psyllid adults, 4th-5th instar nymphs, and 3rd instar nymphs were placed on the isolated plants for bacterial acquisition experiments. The isolated plants were placed in a culture tube, and the position was fixed with a sponge. Placed in a cup-shaped plastic closed environment with an insect-proof net above it, such as figure 2 The effect diagram is shown. Through the screening results, it was found that the 3rd instar and below worms are not easy to survive on the isolated branches, and the adult larvae are less efficient than the 4th-5th instar nymphs. Therefore, the 4th-5th instar nymphs were selected for the bacteria ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com