Application of diaphorina citri ubiquitin-binding enzyme E2J2 gene in prevention and control of citrus huanglongbing
A technology of ubiquitin-conjugating enzyme and citrus Huanglongbing, which is applied in the application field of the citrus psyllid ubiquitin-conjugating enzyme E2J2 gene in the prevention and control of citrus Huanglongbing, which can solve the difficulties in the prevention and control of Huanglongbing, which plagues the citrus industry and biodiversity Destruction and other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] The cDNA sequence of the citrus psyllid ubiquitin-conjugating enzyme E2J2 gene (DcUbcE2J2) shown in SEQ ID NO.1 was entrusted to Nanjing GenScript Biotechnology Co., Ltd. for prokaryotic expression and purification. The purified protein was obtained and verified by Western Blot. The results are as follows figure 1 shown.
Embodiment 2
[0039] The purified protein obtained in Example 1 was subjected to an in vitro ubiquitination binding experiment to detect whether the citrus psyllid ubiquitin-conjugating enzyme E2J2 gene (DcUbcE2J2) of the present invention has ubiquitin-binding activity. The experimental steps are as follows:
[0040] The constructed in vitro ubiquitination reaction system is shown in Table 1:
[0041] Table 1 Constructed in vitro ubiquitination reaction system
[0042]
[0043] The role of imidazole in Table 1 is to prevent the binding of His-tagged E1 and E2 to the nickel-agarose column.
[0044] Since as a ubiquitin-conjugating enzyme, the activation of ubiquitin-activating enzyme E1 is required to achieve the binding function, so the present invention designs two groups of experiments under the same conditions of in vitro ubiquitination liquid environment, the difference lies in whether E1 is activated. Specifically, ①E1+E2+Ub; ②E2+Ub.
[0045]Insert the EP tube containing the rea...
Embodiment 3
[0047] dsRNA synthesis and RNAi experiment
[0048] (1) dsRNA synthesis
[0049] Taking citrus psyllid adult cDNA as a template, by PCR technology, using the amplification primers PT-F: 5'ATTCAAAACCACCAAGCATCT3', PT-R: 5'TCTTCTTGTGCTCGTCTGTCT 3' as shown in SEQ ID NO.3 and SEQ ID NO.4 A partial fragment of the E2J2 gene was obtained, and the amplified product was recovered with the Omega gel recovery kit; the amplified product was ligated into the pMD19-t plasmid, transformed into E. The LB liquid medium was expanded and shaken, and the bacterial solution was sent to Shanghai Sangon Bioengineering Co., Ltd. for sequencing; the bacterial solution with low mutation rate was selected for expansion and the plasmid was extracted (Sigma Rapid Small Plasmid Extraction Kit); using the plasmid as the template, Using primers containing T7 promoters with nucleotide sequences as shown in SEQ ID NO.5 and SEQ ID NO.6, RNAi-F: TAATACGACTCACTATAGGG ATTCAAACCACCAAGCATCT, RNAi-R: TAATACGAC...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap