Cell membrane, nano vaccine and preparation method and application thereof
A nano-vaccine, cell membrane technology, applied in the field of biomedicine, can solve the problem of not producing a lasting immune response, achieve high-efficiency and specific anti-tumor immune response, promote endocytosis and activation, and have wide application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0049] The present invention provides a preparation method of the CD47KO / CRT double bioengineered cell membrane described in the above technical solution, comprising the following steps:
[0050] a) Inoculate tumor cells (B16F10 cells or other types of tumor cells) in a cell culture dish, and culture until the cell confluence is 70%; the number of tumor cells is 50,000 to 1,000,000;
[0051] b) Select commercial gene transfection reagent GoldenTran-S and CD47 gene knockout plasmid, and carry out gene knockout experiment according to the instructions of the transfection reagent. After 24-72 hours, use CD47 fluorescent antibody for cell sorting, and collect CD47 negative tumor cells;
[0052] c) Continue culturing the once gene-edited tumor cells for 3 to 5 days, and perform two rounds of gene editing experiments and cell sorting. The tumor cell line undergoes three rounds of cell sorting to obtain a CD47 knockout tumor cell line (CD47KO-B16F10);
[0053] d) Induction of immunog...
Embodiment 1
[0069] Example 1 Construction of CD47 knockout mouse melanoma B16F10 cell line
[0070] 300,000 B16F10 cells were seeded in cell culture dishes (60 mm in diameter), and 4 mL of RPMI1640 medium containing 12% FBS was added in a medium containing 5% CO. 2 cultured in a 37°C cell incubator. Gene knockout experiments were started when cells grew to 70% confluency. 30 μL of jetprime buffer, 6 μL of gene transfection reagent GoldenTran-S (Changchun Jinchuan Technology Co., Ltd.) and 4 μL of CD47 knockout plasmid (CRISPR / Cas9 gene knockout CD47 gene pX458 vector, purchased from Shanghai Gema Pharmaceutical Technology Co., Ltd.) Co., Ltd., the sgRNA sequence is shown in SEQ ID NO: 2: sgCD47-1: TTGGCGGCGGCGCTGTTGCT) were sequentially added to a 200 μL centrifuge tube, and incubated at room temperature for 10 minutes. Change the medium in the cell culture dish to serum-free medium, then add the complex and shake gently for 10 seconds. After 6 hours of incubation in the cell incubator...
Embodiment 2
[0071] Example 2 Construction of CD47KO / CRT double bioengineered B16F10 cell line
[0072] Construction of CD47KO / CRT dual bioengineered B16F10 cell line by inducing tumor cell immunogenic cell death in vitro: First, the CD47KO-B16F10 cells obtained by gene editing technology in Example 1 were cultured in RPMI1640 containing 10% FBS base, and at 37°C and 5% CO 2 Incubate in an incubator, and when cells grow to 90% confluency, mitoxantrone dihydrochloride (MB1478, Dalian Meilun Biotechnology Co., Ltd.) is added to the medium at a final concentration of 2 μM. After 24 hours of incubation in the incubator, CD47KO / CRT dual bioengineered B16F10 cells were obtained.
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More