Use of protein in preparation of drugs for prevention and treatment of Alzheimer's disease

A technology for Alzheimer's disease, uses, application in the field of biomedicine

Inactive Publication Date: 2019-01-15
XIAMEN UNIV +1
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the function of sTREM2 in AD has not been reported internationally

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of protein in preparation of drugs for prevention and treatment of Alzheimer's disease
  • Use of protein in preparation of drugs for prevention and treatment of Alzheimer's disease
  • Use of protein in preparation of drugs for prevention and treatment of Alzheimer's disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Preparation of embodiment 1 sTREM2 protein

[0046] Construction of pFUSE-sTREM2-TEV-hIgG1-Fc1 expression plasmid: pFUSE-hIgG1-Fc1 (available for purchase) was selected as the eukaryotic expression vector, and EcoR Ⅰ and Xho Ⅰ restriction sites were selected as the cloning site to construct pFUSE-sTREM2-hIgG1- Fcl expression plasmid. The steps are as follows: Design upstream primer: 5'-CG GAATTC ATGGAGCCTCTCCGGCTGC-3'SEQ ID NO: 5 where the underline is the EcoR Ⅰ restriction site;

[0047] Downstream primer: 5'-CCG CTCGAG TT TGGGAAGGGGATTTCTC-3'SEQ ID NO: 6, where the underline is the Xho I restriction site; where the double underline corresponds to the coding sequence of the TEV restriction site: GAAAACCTGTATTTTTCAGGGA SEQ ID NO: 7, and the amino acid sequence of the TEV restriction site is: ENLYFQG SEQ ID NO: 8.

[0048] The nucleotide sequence of TREM2 is (purchased from Beijing Yiqiao Sino Biotechnology Co., Ltd., article number HG11084-M):

[0049] ATGGAGC...

Embodiment 2

[0053] Example 2 Preparation of sTREM2-Fc fusion protein

[0054] Construction of pFUSE-sTREM2-hIgG1-Fc1 expression plasmid: pFUSE-hIgG1-Fc1 was selected as the eukaryotic expression vector, and EcoR Ⅰ and Xho Ⅰ restriction sites were selected as the cloning site to construct the pFUSE-sTREM2-hIgG1-Fc1 expression plasmid. The steps are as follows: Design upstream primer: 5'-CG GAATTC ATGGAGCCTCTCCGGCTGC-3'SEQ ID NO: 5 where the underline is the EcoRI restriction site;

[0055] Downstream primer: 5'-CCG CTCGAG TTTGGGAAGGGGATTTCTC-3'SEQ ID NO: 9 where the underline is the XhoI restriction site;

[0056] Using cDNA (SEQ ID NO: 4) as a template, it can be artificially synthesized, and the sTREM2 expression gene can be cloned by PCR. Gel recovery and purification of the target product, and then restriction endonucleases EcoR Ⅰ and Xho Ⅰ digest pFUSE-hIgG1-Fc1 plasmid, and gel recovery of large fragments. The PCR product was digested with the same enzyme, and the digested prod...

Embodiment 3

[0058] Example 3 Identification of sTREM2 protein and sTREM2-Fc fusion protein

[0059] Identification of protein purity: The sTREM2-Fc fusion protein obtained in Example 2 and the sTREM2 protein obtained in Example 1 were subjected to SDS-PAGE electrophoresis, followed by silver staining to identify their purity. Identification results such as image 3 As shown, the sTREM2-Fc fusion protein and sTREM2 protein have single bands and high purity.

[0060] Identification of protein types: The sTREM2-Fc fusion protein obtained in Example 2 and the sTREM2 protein obtained in Example 1 were transferred to PVDF membrane after SDS-PAGE electrophoresis, and an antibody specifically recognizing the extracellular region of human TREM2 (R&Dsystems, AF1828) were identified by western blot. Identification results such as Figure 4 As shown, both sTREM2-Fc fusion protein and sTREM2 can be recognized by the antibody that recognizes human TREM2, indicating that the constructed protein is co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the use of a protein in preparation of drugs for prevention and treatment of Alzheimer's disease. The amino acid sequence of the protein is shown as SEQ ID NO:2, the protein contains the extracellular fragment 1-171th amino acids of TREM2 receptor protein, and the nucleotide sequence is shown as SEQ ID NO:1. The protein can increase the density of microglial cells, promotethe endocytosis and degradation of microglial cells to Abeta (Amyloid-beta), reduce the intracerebral Abeta level and the deposition of Abeta amyloid plaques, increase the long-term potentiation of CA3-CA1 in the mouse hippocampus region, and strengthen the learning and memory ability of mice.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to the use of a protein for preparing drugs for preventing and treating Alzheimer's disease. Background technique [0002] Alzheimer's disease (AD) is a neurodegenerative disease characterized by progressive loss of cognitive function, and is the most common type of dementia. About 7-10% of people over the age of 65 suffer from AD; and among people over the age of 80, the number is as high as 40%. Currently in China, the number of AD patients has exceeded 8 million, ranking first in the world. Because AD seriously endangers the physical and mental health of the elderly and affects their quality of life, it imposes a heavy burden on patients and their families and has become a serious social problem today. Therefore, it is of great economic and social significance to study the pathogenesis of AD and use it to guide the development of early prevention and diagnosis methods for AD and the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/705A61K38/17A61P25/28
CPCA61K38/00C07K14/70503
Inventor陈小芬卜国军钟力
OwnerXIAMEN UNIV