Unlock instant, AI-driven research and patent intelligence for your innovation.

Freeze-drying protective agent of LAMP freeze-drying microspheres, LAMP freeze-drying microspheres and preparation method of LAMP freeze-drying microspheres

A freeze-drying protective agent, freeze-drying technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as poor effect, achieve good resolubility, good resolubility, and eliminate errors.

Pending Publication Date: 2022-07-29
厦门迈达瑞科技有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the difference in raw materials, the freeze-drying protection agent used in the PCR system is used in the LAMP system, and the effect is not good.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Freeze-drying protective agent of LAMP freeze-drying microspheres, LAMP freeze-drying microspheres and preparation method of LAMP freeze-drying microspheres
  • Freeze-drying protective agent of LAMP freeze-drying microspheres, LAMP freeze-drying microspheres and preparation method of LAMP freeze-drying microspheres
  • Freeze-drying protective agent of LAMP freeze-drying microspheres, LAMP freeze-drying microspheres and preparation method of LAMP freeze-drying microspheres

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] 1. The effect of each component of lyoprotectant on LAMP system

[0024] 1. Materials

[0025] 1.1 Reagent: WarmStart LAMP Kit (DNA&RNA) Cat. No.: (E1700);

[0026] 1.2 Primer: the primer sequence of the African swine fever B646L gene, synthesized by Shanghai Sangon Industrial Co., Ltd., and the purification method is PAGE. The primers in the examples are only examples, and are not limited to the primer sequences.

[0027] The primer sequences are as follows:

[0028] F3: 5' CACACCAACAATACACACC 3' SEQ ID NO: 1;

[0029] B3: 5'AGAGCTGTATCTCTATCCTGA 3'SEQ ID NO:2;

[0030] FIP: 5' GAGGATTTATATCGGAGATGTCCGCTCTTAAATGGCCCATTGA 3' SEQ ID NO: 3;

[0031] BIP: 5'ATACACACCGAGATTGGCACTTATCTCTGCGTGG 3'SEQ ID NO:4;

[0032] LF: 5' GGTAGGTTTATATCCTA 3' SEQ ID NO: 5;

[0033] LB: 5' ACAGCCATTATGCAGCC 3' SEQ ID NO: 6;

[0034] The concentrations of the above primers are shown in Table 1.

[0035] Table 1: Concentration table of each primer

[0036] name concentrat...

Embodiment 2

[0082] Example 2: Preparation of freeze-dried microspheres

[0083] (1) Preparation of lyoprotectant: according to the formula in Table 10.

[0084] Table 10 formula table (1X) of lyophilized protective agent

[0085] trehalose Cyclodextrin Mannitol glycerin Lyophilized Protectant A 4％ 0.30％ 0.10％ 0.50％ Lyophilized Protectant B 4％ 0.30％ 0.40％ 1％ Lyophilized Protectant C 5％ 0.30％ 0.30％ 1％ Lyophilized Protectant D 5％ 0.40％ 0.10％ 1.50％ Lyophilized Protectant E 6％ 0.40％ 0.50％ 2％

[0086] Note: The weight and volume percentage of each component in Table 10 is the percentage of each component in the LAMP freeze-dried microsphere reaction system.

[0087] (2) Preparation of lyophilization reaction premix: according to the formula in Table 11.

[0088] Table 11 Recipe table of lyophilization reaction premix

[0089] Element single serving 100 servings WarmStart LAMP 2X Master Mix 12.5μL 1250μL...

Embodiment 3

[0109] Example 3: Influence of mannitol on freeze-drying system

[0110] (1) Preparation of lyoprotectant: according to the formula in Table 15.

[0111] Formulation table (1X) of table 15 lyophilized protective agent

[0112] trehalose Cyclodextrin Mannitol glycerin Lyophilized Protectant C1 5％ 0.30％ 0％ 1％ Lyophilized Protectant C2 5％ 0.30％ 0.05％ 1％ Lyophilized Protectant C3 5％ 0.30％ 0.1％ 1％ Lyophilized Protectant C4 5％ 0.30％ 0.30％ 1％ Lyophilized Protectant C5 5％ 0.30％ 0.50％ 1％ Lyophilized Protectant C6 5％ 0.30％ 0.70％ 1％ Lyophilized Protectant C7 5％ 0.30％ 0.90％ 1％

[0113] (2) Preparation of lyophilization reaction premix: according to the formula in Table 16.

[0114] The formula table of table 16 freeze-drying reaction premix

[0115] Element single serving 100 servings WarmStart LAMP 2X Master Mix 12.5μL 1250μL Fluorescent dye(50X) 0.5μL 50μL LAMP Pri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a freeze-drying protective agent of an LAMP freeze-drying microsphere, the LAMP freeze-drying microsphere and a preparation method of the LAMP freeze-drying microsphere. A freeze-drying protective agent of the LAMP freeze-dried microspheres contains trehalose, beta-cyclodextrin, mannitol and glycerol. The damage of the freeze-dried LAMP reagent to the active components in the processes of preparation, split charging and the like can be reduced to the maximum extent, the activity of the freeze-dried LAMP reagent is not reduced, the freeze-dried LAMP reagent does not easily absorb moisture, and the freeze-dried LAMP reagent has good redissolvability; meanwhile, the sensitivity, the precision and other properties of the LAMP system are not influenced; the validity period of the LAMP reagent is remarkably prolonged, and the prepared freeze-dried reagent can be placed at room temperature for at least one year without cryopreservation and dry ice transportation. The prepared freeze-dried microspheres are stable in structure and good in resolubility. One-tube freeze-drying can be achieved, a user does not need to temporarily prepare a reaction system, operation is easy and convenient, and result errors caused by manual operation are eliminated.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a freeze-drying protective agent for LAMP freeze-dried microspheres, LAMP freeze-dried microspheres and a preparation method thereof. Background technique [0002] Loop-mediated isothermal amplification (LAMP) is a new nucleic acid amplification technology developed after PCR technology. It has the characteristics of simplicity, rapidity and strong specificity. The technology can be comparable to or even better than PCR technology in terms of sensitivity, specificity and detection range. Through a series of strand displacement amplification reactions, this method can amplify the target gene by 109 times within 1 hour. In the case of RNA, the method can also realize the amplification of RNA by adding reverse transcriptase to the reaction system. The LAMP detection technology has a simple operation method and a short reaction time. The reaction can be completed in a constant temperat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6844
CPCC12Q1/6844C12Q2531/119C12Q2527/125
Inventor 黄拔严陈仁良唐骏
Owner 厦门迈达瑞科技有限公司