Check patentability & draft patents in minutes with Patsnap Eureka AI!

Plant expression vector of gene CmMYB15-like for improving aphid resistance of chrysanthemum and application of plant expression vector

A pmdc43-cmmyb15-like, plant expression vector technology, applied in the field of plant expression vectors and their construction, can solve the problems of excavation and utilization of excellent aphid resistance genes, aphid drug resistance, etc., to improve aphid resistance, Excellent resistance to aphids and the effect of increasing cell wall thickness

Pending Publication Date: 2022-08-09
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Purpose of the invention: In view of the existing chemical insecticide methods that easily cause aphids to develop drug resistance, and the lack of excavation and utilization of genes with excellent aphid resistance, the present invention aims to provide a brand new SG2 R2R3MYB family that can significantly improve the aphid resistance of chrysanthemums Gene CmMYB15-like, plant expression vector and its construction method and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant expression vector of gene CmMYB15-like for improving aphid resistance of chrysanthemum and application of plant expression vector
  • Plant expression vector of gene CmMYB15-like for improving aphid resistance of chrysanthemum and application of plant expression vector
  • Plant expression vector of gene CmMYB15-like for improving aphid resistance of chrysanthemum and application of plant expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1: Obtaining the CmMYB15-like gene that directly regulates the lignin synthesis gene Cm4CL2 The AC-I (ACCTACC) and AC-II (ACCAACC) cis-acting elements that regulate lignin synthesis in the promoter region of Cm4CL2 were constructed by repeating them in tandem. To pHIS2 vector, it was used as 'bait' to screen chrysanthemum yeast one-hybrid library to obtain annotated gene encoding MYB protein CmMYB15-like ( figure 1 ).

Embodiment 2

[0060] Example 2: Cloning of Chrysanthemum CmMYB15-like gene

[0061] Take chrysanthemum 'Shenma' leaves as material, take 0.2 g of leaves, extract total RNA from leaves according to the operation method of the RNA extraction kit (Hua Yue Yang), and perform reverse transcription according to the instructions of the reverse transcription kit (TaKaRa) to obtain cDNA , according to the sequence information of the CmMYB15-like gene in the chrysanthemum library, use the primer5 software to design specific primers to amplify CmMYB15-like;

[0062] Upstream primer CmMYB15-like-F: ATGGGGAGAGCACCTTGTTG (SEQ ID NO: 5);

[0063] Downstream primer CmMYB15-like-R: TTAAAACTCAGGTAACTCGG (SEQ ID NO: 6).

[0064] The reverse transcribed leaf cDNA was used as a template for PCR reaction, 50 μL reaction system: 5×Phusion HFbuffer 10.0 μL, CmMYB15-like-F (10 μM), CmMYB15-like-R (10 μM) primers 2.5 μL (10 μM) each, dNTP (2.5mM) 4.0μL, Phusion DNA Polymerase 0.5μL, cDNA template 1μL, ddH 2 O 29....

Embodiment 3

[0065] Example 3: Construction of plant expression vector pMDC43-CmMYB15-like

[0066] The construction process of plant expression vector pMDC43-CmMYB15-like is as follows image 3 As shown, according to the CmMYB15-like gene sequence, BamH I and Xho I restriction sites were introduced upstream and downstream, respectively, and primers CmMYB15-like-GATE-F and CmMYB15-like-GATE-R were designed:

[0067] CmMYB15-like-GATE-F: CGGGATCCGGATGGGGAGAGCACCT (SEQ ID NO: 7);

[0068] CmMYB15-like-GATE-R: CCGCTCGAGTGAAACTCAGGTAACTC (SEQ ID NO: 8).

[0069] Use the pMD19-T-CmMYB15-like plasmid containing the CmMYB15-like gene sequence as a template to carry out PCR reaction, 50 μL reaction system: 5×Phusion HF buffer 10.0 μL, CmMYB15-like-GATE-F (10 μM), CmMYB15-like- GATE-R (10μM) primer 2.5μL each (10μM), dNTP (2.5mM) 4.0μL, Phusion DNAPolymerase 0.5μL, pMD19-T-CmMYB15-like plasmid template 1μL, ddH 2 O 29.5 μL; reaction program: pre-denaturation at 98°C for 30sec; 98°C for 10sec, 58...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene CmMYB15-like for improving aphid resistance of chrysanthemum, a plant expression vector as well as a construction method and application of the gene CmMYB15-like. The gene has a sequence as shown in SEQ ID NO: 1, and lignin synthesis is regulated and controlled by up-regulating the gene expression level of 4-coumaric acid coenzyme A ligase, so that the thickness of cell walls is increased, and the aphid resistance of chrysanthemum is improved. Meanwhile, a corresponding plant expression vector is constructed by the gene; the gene and the plant expression vector thereof can be used for cultivating aphid-resistant transgenic plants, specifically, the aphid-resistant gene CmMYB15-like is obtained by taking chrysanthemum 'Shenma' as a material, the plant expression vector of the aphid-resistant gene CmMYB15-like is constructed, and the aphid-resistant gene CmMYB15-like is introduced into the chrysanthemum 'Shenma' through an agrobacterium-mediated method. Aphid inoculation treatment is carried out on the transgenic plant and the wild type, the aphid resistance of the transgenic plant is obviously enhanced, and an excellent gene reserve and a new strategy are provided for chrysanthemum aphid resistance engineering breeding.

Description

technical field [0001] The invention relates to a plant expression vector for improving aphid resistance gene of chrysanthemum and its application, in particular to a gene CmMYB15-like which can improve chrysanthemum resistance to aphid, a plant expression vector and its construction method and application. Background technique [0002] Chrysanthemum (Chrysanthemum morifolium) is susceptible to aphids, thrips, chrysanthemum spider mites, red spiders, whiteflies and other pests in artificial selection and cultivation. Among them, aphid damage is one of the most important pests, especially chrysanthemum long. The tube aphid (Macrosiphoniella sanbourni) is the most serious damage to chrysanthemum, which directly restricts the growth of chrysanthemum, affects the ornamental quality, and spreads viruses, resulting in serious economic losses. The application of chemical pesticides is still the most important method to control aphids at present, but long-term application can easily...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/84C12N15/64A01H5/00A01H6/14C12Q1/6895C12N15/11
CPCC07K14/415C12N15/8205C12N15/8286C12Q1/6895C12Q2600/13C12Q2600/158
Inventor 陈素梅李菲甘好张一王新慧蒋甲福周李杰王利凯陈发棣
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More