Method for detecting prawn virus by compound polymerase Chain -enzyme-linked immune reaction
An enzyme-linked immune reaction and polymerase chain technology, which is applied in the field of composite polymerase chain-enzyme-linked immune reaction detection of shrimp viruses, can solve problems such as no related reports on the composite detection technology of hepatopancreatic parvovirus, and achieves high sensitivity, simple process, Easy-to-use effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0030] Specific steps are as follows:
[0031] (1) Design and screening of specific oligonucleotide probes and amplification primers: According to the viral genome sequence design, the end-labeled biotin capture probes of shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus The sequence is: biotin-ACTGTCACTGTTGCT; biotin-AGTTAGAACGGATAG; biotin-AGCAAGGTAGAGCTG, the upstream and downstream primer sequences for amplifying white spot syndrome virus are: TGATTTGTTGTGCCCTTTTG, ACGTAGGGTCGATGTTGGTG; the upstream and downstream sequences for amplifying hepatopancreatic parvovirus are: ACACAGCAATATGATCAAGAGAAA, GCACTGGCCATCGTATCTT ; The sequences of upstream and downstream primers for amplifying Taura syndrome virus are: TCGCTGCATGAGAAGGGTTAT, TTTTCGATGCAGATGGGTAAC. The lengths of the probes for detecting the amplified products of white spot syndrome virus, hepatopancreatic parvovirus and Taura syndrome virus are 331 base pairs, 194 base pairs and 236...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com