Method for producing anti-cancer medicine from silkworm
A therapeutic drug and anti-tumor technology, applied in anti-tumor drugs, drug combinations, pharmaceutical formulations, etc., can solve the problems of difficult sources of natural endostatin, protein denaturation, high production costs, etc., to relieve pain and the threat of infection, The effect of stable gene expression products and avoiding cumbersome operations
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0015] Primers were designed according to the published human endostatin gene sequence (Cell 1997; 88:277-85), and BamHI and XbaI sites were designed at the 5 and 3 ends, respectively. The upstream primer is: 5GGGGATCCATGCACAGCCACCGCGACT3', the downstream primer is: 5'TTTCTAGATTACTTGGAGGCAGTCATG3', take 100 mg of human liver tissue cells, grind them at low temperature, add 1 ml of Trizol RNA extract produced by GIBCOBRL, shake gently for 10 minutes, and then add 500 μl of chloroform (Zhejiang Di Ear Pharmaceutical Co., Ltd.), placed at room temperature for 10 minutes, centrifuged at 12000rpm for 10 minutes, took the supernatant, added 2 times the volume of ethanol, mixed well, centrifuged at 12000rpm for 10 minutes, discarded the supernatant, and added 1000 units of reverse transcriptase (GIBCOBRL) and 4dNTP (GIBCOBRL) were reverse-transcribed at 37° C. for 1 hour to obtain cDNA synthesized by reverse-transcribing mRNA. PCR amplification of the human endostatin gene. The reac...
Embodiment 2
[0016] From the pUC-Endo plasmid digested with BamHI and XbaI, the digested fragment was connected to pBacPAK8 (CLONTECH company) which was also digested with BamHI and XbaI, and the baculovirus transfer plasmid pBac-Endo containing the human endostatin gene was constructed ( image 3 ), the gene was identified to be correct by restriction analysis. Embodiment 3, the acquisition of the recombinant baculovirus of human endostatin gene
Embodiment 3
[0017]Take 5ul insect baculovirus transfer plasmid pBac-Endo containing human endostatin gene and 6ul wild silkworm nuclear polyhedrosis virus DNA for co-transfection. Take 6ul Lipofectin (GIBCOBRL company) and add 100ul serum-free TC-100 medium and mix well. The BmN cells previously cultured in a 35mm Dish were washed twice with serum-free TC-100 (GIBCOBRL company) medium, and the transfer plasmid and Lipofectin mixture was added dropwise, cultured at 27°C for 4-5 days, and the supernatant was collected for the second stage. One round of plaque screening. Take 5ul of the supernatant to infect the BmN cells in a 35mm Dish, discard the supernatant after 1 hour and add an equal amount of mixed TC-100 medium and low melting point agarose. Pick plaques after 4-5 days, infect BmN cells for 3-4 days, save the supernatant, lyse the cells with NaOH for Southern hybridization, and take the supernatant of positive clones for the 10th round of plaque screening. The supernatant of posit...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com