Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for producing anti-cancer medicine from silkworm

A therapeutic drug and anti-tumor technology, applied in anti-tumor drugs, drug combinations, pharmaceutical formulations, etc., can solve the problems of difficult sources of natural endostatin, protein denaturation, high production costs, etc., to relieve pain and the threat of infection, The effect of stable gene expression products and avoiding cumbersome operations

Inactive Publication Date: 2003-04-09
浙江中奇生物药业股份有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the source of natural endostatin is difficult. Endostatin can be expressed in the E. coli system, and the expression level is relatively high, but it does not contain glycosylation and forms inclusion bodies, which involves protein denaturation and renaturation issues, as well as post-processing Brings tedious multi-step operations. Mammalian cells can be used to produce endostatin, but culture medium and bovine serum are required for cultivation. The production cost is high, and low expression is also a problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing anti-cancer medicine from silkworm
  • Method for producing anti-cancer medicine from silkworm
  • Method for producing anti-cancer medicine from silkworm

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] Primers were designed according to the published human endostatin gene sequence (Cell 1997; 88:277-85), and BamHI and XbaI sites were designed at the 5 and 3 ends, respectively. The upstream primer is: 5GGGGATCCATGCACAGCCACCGCGACT3', the downstream primer is: 5'TTTCTAGATTACTTGGAGGCAGTCATG3', take 100 mg of human liver tissue cells, grind them at low temperature, add 1 ml of Trizol RNA extract produced by GIBCOBRL, shake gently for 10 minutes, and then add 500 μl of chloroform (Zhejiang Di Ear Pharmaceutical Co., Ltd.), placed at room temperature for 10 minutes, centrifuged at 12000rpm for 10 minutes, took the supernatant, added 2 times the volume of ethanol, mixed well, centrifuged at 12000rpm for 10 minutes, discarded the supernatant, and added 1000 units of reverse transcriptase (GIBCOBRL) and 4dNTP (GIBCOBRL) were reverse-transcribed at 37° C. for 1 hour to obtain cDNA synthesized by reverse-transcribing mRNA. PCR amplification of the human endostatin gene. The reac...

Embodiment 2

[0016] From the pUC-Endo plasmid digested with BamHI and XbaI, the digested fragment was connected to pBacPAK8 (CLONTECH company) which was also digested with BamHI and XbaI, and the baculovirus transfer plasmid pBac-Endo containing the human endostatin gene was constructed ( image 3 ), the gene was identified to be correct by restriction analysis. Embodiment 3, the acquisition of the recombinant baculovirus of human endostatin gene

Embodiment 3

[0017]Take 5ul insect baculovirus transfer plasmid pBac-Endo containing human endostatin gene and 6ul wild silkworm nuclear polyhedrosis virus DNA for co-transfection. Take 6ul Lipofectin (GIBCOBRL company) and add 100ul serum-free TC-100 medium and mix well. The BmN cells previously cultured in a 35mm Dish were washed twice with serum-free TC-100 (GIBCOBRL company) medium, and the transfer plasmid and Lipofectin mixture was added dropwise, cultured at 27°C for 4-5 days, and the supernatant was collected for the second stage. One round of plaque screening. Take 5ul of the supernatant to infect the BmN cells in a 35mm Dish, discard the supernatant after 1 hour and add an equal amount of mixed TC-100 medium and low melting point agarose. Pick plaques after 4-5 days, infect BmN cells for 3-4 days, save the supernatant, lyse the cells with NaOH for Southern hybridization, and take the supernatant of positive clones for the 10th round of plaque screening. The supernatant of posit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of gene engineering technology of producing polypeptide medicine. By means of Bombyx mori nuclear polyhedrosis virus to recombine human endostatin gene, recombinant virus is obtained, which is preserved in China Microbe Strain Preservation Committee in the number of CGMCC No.0592. The virus is used in inocualting Bombyx mori larva and pupa for expression, and through separation to purity and freeze drying, injection and orally taken medicine is prepared. Animal experiment to mouse shows that the medicine has obvious effect of inhibiting tumor growth. The present invention provides one new method of preparing tumor treating medicine which low cost and high treating effect.

Description

technical field [0001] The invention relates to a method for preparing human endostatin from silkworm larvae and pupae through the silkworm baculovirus expression system, and also relates to a method for preparing antitumor therapeutic drugs by using silkworm larvae and pupae to produce human endostatin. Background technique [0002] The formation of new blood vessels is one of the necessary conditions for the growth and metastasis of almost all solid tumors. When the tumor grows to a diameter of about 1-2 mm, further growth depends on blood vessels to provide oxygen and nutrients for it. Therefore, blocking the formation of new blood vessels can inhibit the growth of tumors, reduce and prevent the occurrence of metastasis. "Grain and Grass" is a new strategy for the treatment of tumors. In 1997, O'Reilly et al. used a similar method to isolate a brand new 20kD protein from the culture medium of rat hemangioendothelioma cells cultured in vitro. Its amino acid sequence is id...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/17A61P35/00C12N15/63C12N15/86
Inventor 张耀洲金勇丰吴祥甫
Owner 浙江中奇生物药业股份有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com