Method for detecting prawn virus by compound polymerase Chain -enzyme-linked immune reaction
A technology of ELISA and polymerase chain reaction, which is applied in the field of composite polymerase chain-ELISA detection of prawn virus, can solve the problems such as the lack of related reports of hepatopancreatic parvovirus composite detection technology, achieve high sensitivity, convenient operation, The effect of simple process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0030] Specific steps are as follows:
[0031] (1) Design and screening of specific oligonucleotide probes and amplification primers: According to the viral genome sequence design, the end-labeled biotin capture probes of shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus The sequence is: biotin-ACTGTCACTGTTGCT; biotin-AGTTAGAACGGATAG; biotin-AGCAAGGTAGAGCTG, the upstream and downstream primer sequence for amplifying white spot syndrome virus is: TGATTTGTTGTGCCCTTTTGACGTAGGGTCGATGTTGGTG; the upstream and downstream sequence for amplifying hepatopancreatic parvovirus is: ACACAGCAATATGATCAAGAGAAA, GCACTGGCCATCGTATCTT; The sequences of the upstream and downstream primers for Zentaura syndrome virus are: TCGCTGCATGAGAAGGGTTAT, TTTTCGATGCAGATGGGTAAC. The lengths of the probes for detecting the amplified products of white spot syndrome virus, hepatopancreatic parvovirus and Taura syndrome virus are 331 base pairs, 194 base pairs and 236 base pairs...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com