Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method

A technology of genetic markers and sclerophytes, which is applied to biochemical equipment and methods, and microbial measurement/inspection, can solve problems such as heavy workload, time-consuming, and laborious

Inactive Publication Date: 2004-10-13
OCEAN UNIV OF CHINA +1
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional morphological method has always been used in the detection of Skeletons costa. This method is cumbersome, time-consuming and labor-intensive, and the workload is huge when the sample volume is large.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method
  • Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method
  • Quick quantitative detection of genetic marker of skeletonema costatum japonicum and its method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Preparation of Genetic Markers for Detection of Skeletons costanum

[0043] The Skeletalum costatum used in the present invention is isolated from natural seawater samples of Jiaozhou Bay. Pure cultures are obtained by repeatedly picking individual algal cells under a microscope. The culture medium used is conventional F / 2 culture medium, and the culture conditions are: the light / dark cycle is 12h / 12h, the light intensity is 4000Lx, and the culture temperature is 22°C-25°C.

[0044] Use a 0.45 μm microporous membrane or centrifuge at 10,000 r / min to collect the cells of Skeletalum costatum in the logarithmic growth phase, and use 200 μl TE buffer (10mmol / L Tris-HCl pH8.0, 1mmol / L EDTA pH8.0 ) to wash about 20 mg of algal body, add 2 times the volume of extraction buffer (3% (w / v) CTAB, 1% (w / v) sodium lauryl sarcosine, 20 mmol / L EDTA, 1.4mol / L NaCl, 0.1mol / LTris-HCl pH8.0, 1% (v / v) 2-mercaptoethanol), 55 ° C for 1 hour, during which time every 10 minutes to mix once;...

Embodiment 2

[0046] Example 2. Design and synthesis of Skeletons costa-specific primer pairs and probes

[0047] By comparing with the sequences of the corresponding regions of all known other eukaryotes and prokaryotes in Genbank, it is found that the sequence shown in SEQ ID NO: 11 is very different from the corresponding sequences of other organisms. The sequence was used as a basis for designing primer pairs for each nucleic acid molecule in Table 1. Based on the nucleotide composition and arrangement of these primer pairs, each primer was synthesized on a commercial DNA synthesizer. Primers 1, 3, 5 and 7 are upstream primers, and primers 2, 4, 6 and 8 are downstream primers.

[0048] Primer

Sequence (5'-3')

SEQ ID NO:

1

AAACCTTTACTTCCCCGAGAAGAG

1

2

GATGTCTTGGGTCACACAACGAT

2

3

CCAAACCTTTACTTCCCCCGAG

3

4

CCGCCCATTACCGAACTG

4

5

ACTTCCCCGAGAAGAGGC

5

6

TGG...

Embodiment 3

[0052] Example 3. Detection of Scutellaria costatum by conventional PCR method

[0053] In this embodiment, several dominant phytoplankton plants commonly seen in Jiaozhou Bay were selected as reference algae, and they are: Chaetoceros spinosa, Chaetoceros fragilis, Chaetoceros slender, Gymnodinosa, Gymnodinosa michaelii, Tamar Alexander Algae, Thalassiosira knowlesi, Pseudomonas spikina, Nitzschia lunster, and Navicula membranous, all of them were isolated from natural seawater of Jiaozhou Bay, and pure cultures were obtained by repeatedly picking individual algal cells under a microscope. These algae were cultured and the DNA of these algae and Skeletalum costatum were extracted according to the method described in Example 1.

[0054] Take 1 μl of DNA extracts from various algae, and perform PCR according to the PCR reaction system described in Example 1, using primers 1 and 2 (SEQ ID NO: 1 and 2) as forward and reverse primers. The PCR program is: 94°C for 3min; 94°C for 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a genetic marker and method for quickly quantitatively detecting skeletonema costatum. It provides skeletonema costatum ribosomal DNA (rDNA) and transcription unit internal spacer (ITS) nucleotide sequence, and oligonucleotide probe designed by using said sequence as basis. The invention utilizes the sequence comparison and experiment to show that these probes are genetic marker peculiary to the skeletonema costatum. The invention also provides the method for quickly quantitatively detecting skeletonema costatum.

Description

technical field [0001] The invention belongs to the technical field of detecting marine phytoplankton by means of molecular biology methods. It relates to a nucleotide sequence that can be used for detecting Skeletons costarum and a method for detecting Skeletons costa based on the sequence. Background technique [0002] Skeletonema costatum is a kind of eurythermal and euryhaline phytoplankton that widely exists in the world, and it is also one of the most common dominant species of diatoms in my country's coastal waters. This species is a good bait for marine secondary producers, with a rapid multiplication rate, experiments have shown that the number of cell divisions is up to six times per day. But on the other hand, Sclerotina mesocostalis is a common red tide organism and a good pollution indicator organism in the coastal waters of my country. In the economic seaweed breeding area, it often competes with kelp and laver for nutrients. A large number of blooms of this s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/00C12Q1/68
Inventor于志刚李荣秀苟万里米铁柱
OwnerOCEAN UNIV OF CHINA