Unlock instant, AI-driven research and patent intelligence for your innovation.

High anti-mercury offensive smell pseudomonas strain CHY-7 and use in treating mercury pollution

A technology of Pseudomonas putida and CHY-7, applied in the restoration of contaminated soil, bacteria, energy and wastewater treatment, etc., to achieve the effect of strong reduction of ion mercury and strong viability of nature

Inactive Publication Date: 2005-10-19
FUJIAN MEDICAL UNIV
View PDF1 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Retrieval of related materials, including Chinese patents, shows that there are no relevant reports on the isolation of mercury-resistant strains from mercury-contaminated soil and the use of mercury-resistant microorganisms to remove mercury pollution.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High anti-mercury offensive smell pseudomonas strain CHY-7 and use in treating mercury pollution
  • High anti-mercury offensive smell pseudomonas strain CHY-7 and use in treating mercury pollution
  • High anti-mercury offensive smell pseudomonas strain CHY-7 and use in treating mercury pollution

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1: The screening steps of the highly mercury-resistant Pseudomonas putida CHY-7 bacterial strain of the present invention are as follows:

[0045] Soil samples were collected from the mercury-contaminated soil of an abandoned sunlight bulb factory in Fujian Province. Take 10g of the sample, mash it well, and add 10ml containing HgCl 2 LB liquid medium (Hg 2+ Concentration is 25mg / L) suspension, after natural precipitation, 100g centrifugation takes supernatant, smears on containing 25mg / L Hg 2+ LB plates were incubated at 28°C for 24h.

[0046] from Hg 2+ Selective medium (Hg 2+ From the single colonies grown on the LB plate), 7 mercury-resistant strains (numbered as CHY-1, CHY-2, CHY-3, CHY-4, CHY-5, CHY-6 and CHY-7) were selected for resistance Mercury drug level detection. Inoculate the colony to be tested in a solution containing 25mg / L Hg 2+ In the LB culture medium, the bacteria grow to the logarithmic phase, and inoculated with HgCl at a ratio of...

Embodiment 2

[0062] Example 2: Using 16S rRNA gene classification to identify highly mercury-resistant Pseudomonas putida CHY-7 strain

[0063] Genomic DNA of CHY-7 bacteria was extracted using Wizard Genomic DNA purification Kit, and primers were designed and synthesized based on the conserved sequence in the bacterial 16S rRNA gene. PCR primers: upstream primer 16S-F: 5'-TgCCAgCAgCCgCggTAA-3'; downstream primer 16S-R: 5'-AggCCCgggAACgTATTCAC-3'. The PCR reaction conditions were 94°C / 3mim; 94°C / 45s, 56°C / 30s, 72°C / 1min, 30 cycles; 72°C / 7min. PCR products were sequenced by Dalian Bao Biological Company. DNA sequencing results are as follows:

[0064] ACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAATCCC

[0065] CGGGCTCAACCTGGGAACTGCATTCAAACTGACAAGCTAGAGTATGGTA

[0066] GAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGG

[0067] AACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAGGTGC

[0068] GAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTA

[0069] AACGATGTCAACTAGCCGTTGGGAGCCTTGAGCTCTT...

Embodiment 3

[0081] Example 3: Nested PCR identification of the mer4 gene of the highly mercury-resistant Pseudomonas putida CHY-7 strain

[0082] According to the merA gene sequence and homology comparative analysis provided by the GenBank database, use biological software such as Generunner to design PCR primers in the highly conserved DNA sequence region of the merA gene (merA-F45: 5'-ggCgCACgTCAAggAAgC-3'; merA-F352: 5' -gTCgAgCAAggCgCgCAg-3'; merA-R541: 5'-gACACgggCCTgCTgCTg-3'; merA-R756: 5'-gTCCAgTAgggTgACTCTTTC-3'; 4 pairs of primers are composed of merA-F45 / merA-R541, merA-F45 / merA- R756, merA-F352 / merA-R541 and merA-F352 / merA-R756), using CHY-7 bacterial genomic DNA as a template, PCR amplifies the corresponding DNA fragments. The PCR reaction conditions were 94°C / 3min: 94°C / 45s, 54-58°C / 30s, 72°C / 1min, a total of 30 cycles; 72°C / 7min.

[0083] The PCR products were analyzed by agarose gel electrophoresis, ethidium bromide staining and UV imaging system, and the results showed t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of environment tackling with microbes. The strain is pseudomonasputida CHY-7 separated from mercury contaminated soil and preserved in Chinese typical culture preserving center. Pseudomonasputida CHY-7 is suitable for culture in neutral, weak acid or weak alkaline culture medium at normal temperature, and may grow in water or soil. Pseudomonasputida CHY-7 is aerobic Gram-negativre bacterium and has size of (2.0-4.0)x(0.7-1.1) micron and no spore generated. It forms yellowish colony with smooth raised edge and can generate fluorescence in chromogenesis culture medium. It has high effect of reducing ionic mercury into volatile mercury element and may be applied widely in tackling mercury contaminated environment.

Description

technical field [0001] The invention relates to the project of using microorganisms to implement environmental protection treatment, in particular to a strain of highly mercury-resistant Pseudomonas putida CHY-7 and its application in the treatment of mercury pollution. Background technique [0002] In 2003, the United Nations Environment Program published a report showing that since the industrial revolution, the content of mercury in the atmosphere, water, and soil has increased by about three times, and the content of mercury in the vicinity of industrial areas is even higher, and mercury pollution continues to aggravate It has caused great harm to human health and the environment. [0003] Mercury is a natural component in the natural environment, and its background level in nature is not high, for example, the content of surface water is less than 0.1μg / m 3 , the content in the atmosphere is 0.001~50μg / m 3 , the average content in soil is 0.1μg / g. However, the mining...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): B09C1/10C02F3/34C12N1/20
CPCY02W10/37
Inventor 陈贻锴阳菊华詹丽钦包幼迪
Owner FUJIAN MEDICAL UNIV