High anti-mercury offensive smell pseudomonas strain CHY-7 and use in treating mercury pollution
A technology of Pseudomonas putida and CHY-7, applied in the restoration of contaminated soil, bacteria, energy and wastewater treatment, etc., to achieve the effect of strong reduction of ion mercury and strong viability of nature
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Embodiment 1: The screening steps of the highly mercury-resistant Pseudomonas putida CHY-7 bacterial strain of the present invention are as follows:
[0045] Soil samples were collected from the mercury-contaminated soil of an abandoned sunlight bulb factory in Fujian Province. Take 10g of the sample, mash it well, and add 10ml containing HgCl 2 LB liquid medium (Hg 2+ Concentration is 25mg / L) suspension, after natural precipitation, 100g centrifugation takes supernatant, smears on containing 25mg / L Hg 2+ LB plates were incubated at 28°C for 24h.
[0046] from Hg 2+ Selective medium (Hg 2+ From the single colonies grown on the LB plate), 7 mercury-resistant strains (numbered as CHY-1, CHY-2, CHY-3, CHY-4, CHY-5, CHY-6 and CHY-7) were selected for resistance Mercury drug level detection. Inoculate the colony to be tested in a solution containing 25mg / L Hg 2+ In the LB culture medium, the bacteria grow to the logarithmic phase, and inoculated with HgCl at a ratio of...
Embodiment 2
[0062] Example 2: Using 16S rRNA gene classification to identify highly mercury-resistant Pseudomonas putida CHY-7 strain
[0063] Genomic DNA of CHY-7 bacteria was extracted using Wizard Genomic DNA purification Kit, and primers were designed and synthesized based on the conserved sequence in the bacterial 16S rRNA gene. PCR primers: upstream primer 16S-F: 5'-TgCCAgCAgCCgCggTAA-3'; downstream primer 16S-R: 5'-AggCCCgggAACgTATTCAC-3'. The PCR reaction conditions were 94°C / 3mim; 94°C / 45s, 56°C / 30s, 72°C / 1min, 30 cycles; 72°C / 7min. PCR products were sequenced by Dalian Bao Biological Company. DNA sequencing results are as follows:
[0064] ACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAATCCC
[0065] CGGGCTCAACCTGGGAACTGCATTCAAACTGACAAGCTAGAGTATGGTA
[0066] GAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGG
[0067] AACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAGGTGC
[0068] GAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTA
[0069] AACGATGTCAACTAGCCGTTGGGAGCCTTGAGCTCTT...
Embodiment 3
[0081] Example 3: Nested PCR identification of the mer4 gene of the highly mercury-resistant Pseudomonas putida CHY-7 strain
[0082] According to the merA gene sequence and homology comparative analysis provided by the GenBank database, use biological software such as Generunner to design PCR primers in the highly conserved DNA sequence region of the merA gene (merA-F45: 5'-ggCgCACgTCAAggAAgC-3'; merA-F352: 5' -gTCgAgCAAggCgCgCAg-3'; merA-R541: 5'-gACACgggCCTgCTgCTg-3'; merA-R756: 5'-gTCCAgTAgggTgACTCTTTC-3'; 4 pairs of primers are composed of merA-F45 / merA-R541, merA-F45 / merA- R756, merA-F352 / merA-R541 and merA-F352 / merA-R756), using CHY-7 bacterial genomic DNA as a template, PCR amplifies the corresponding DNA fragments. The PCR reaction conditions were 94°C / 3min: 94°C / 45s, 54-58°C / 30s, 72°C / 1min, a total of 30 cycles; 72°C / 7min.
[0083] The PCR products were analyzed by agarose gel electrophoresis, ethidium bromide staining and UV imaging system, and the results showed t...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com